ID: 1187698181

View in Genome Browser
Species Human (GRCh38)
Location X:21941156-21941178
Sequence GGAGCGCGGGTGGACGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698181_1187698197 23 Left 1187698181 X:21941156-21941178 CCCTGGCCGTCCACCCGCGCTCC 0: 1
1: 0
2: 2
3: 11
4: 188
Right 1187698197 X:21941202-21941224 CTCCCGCTCGGGGAGTCCCCGGG 0: 1
1: 0
2: 0
3: 18
4: 123
1187698181_1187698200 30 Left 1187698181 X:21941156-21941178 CCCTGGCCGTCCACCCGCGCTCC 0: 1
1: 0
2: 2
3: 11
4: 188
Right 1187698200 X:21941209-21941231 TCGGGGAGTCCCCGGGCTGCCGG 0: 1
1: 0
2: 1
3: 16
4: 177
1187698181_1187698193 12 Left 1187698181 X:21941156-21941178 CCCTGGCCGTCCACCCGCGCTCC 0: 1
1: 0
2: 2
3: 11
4: 188
Right 1187698193 X:21941191-21941213 CCGCCTTCGCGCTCCCGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1187698181_1187698191 11 Left 1187698181 X:21941156-21941178 CCCTGGCCGTCCACCCGCGCTCC 0: 1
1: 0
2: 2
3: 11
4: 188
Right 1187698191 X:21941190-21941212 GCCGCCTTCGCGCTCCCGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 75
1187698181_1187698196 22 Left 1187698181 X:21941156-21941178 CCCTGGCCGTCCACCCGCGCTCC 0: 1
1: 0
2: 2
3: 11
4: 188
Right 1187698196 X:21941201-21941223 GCTCCCGCTCGGGGAGTCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 122
1187698181_1187698194 13 Left 1187698181 X:21941156-21941178 CCCTGGCCGTCCACCCGCGCTCC 0: 1
1: 0
2: 2
3: 11
4: 188
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698181 Original CRISPR GGAGCGCGGGTGGACGGCCA GGG (reversed) Intronic