ID: 1187698182

View in Genome Browser
Species Human (GRCh38)
Location X:21941157-21941179
Sequence GGGAGCGCGGGTGGACGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 308}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698182_1187698201 30 Left 1187698182 X:21941157-21941179 CCTGGCCGTCCACCCGCGCTCCC 0: 1
1: 0
2: 3
3: 34
4: 308
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269
1187698182_1187698193 11 Left 1187698182 X:21941157-21941179 CCTGGCCGTCCACCCGCGCTCCC 0: 1
1: 0
2: 3
3: 34
4: 308
Right 1187698193 X:21941191-21941213 CCGCCTTCGCGCTCCCGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1187698182_1187698197 22 Left 1187698182 X:21941157-21941179 CCTGGCCGTCCACCCGCGCTCCC 0: 1
1: 0
2: 3
3: 34
4: 308
Right 1187698197 X:21941202-21941224 CTCCCGCTCGGGGAGTCCCCGGG 0: 1
1: 0
2: 0
3: 18
4: 123
1187698182_1187698191 10 Left 1187698182 X:21941157-21941179 CCTGGCCGTCCACCCGCGCTCCC 0: 1
1: 0
2: 3
3: 34
4: 308
Right 1187698191 X:21941190-21941212 GCCGCCTTCGCGCTCCCGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 75
1187698182_1187698196 21 Left 1187698182 X:21941157-21941179 CCTGGCCGTCCACCCGCGCTCCC 0: 1
1: 0
2: 3
3: 34
4: 308
Right 1187698196 X:21941201-21941223 GCTCCCGCTCGGGGAGTCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 122
1187698182_1187698200 29 Left 1187698182 X:21941157-21941179 CCTGGCCGTCCACCCGCGCTCCC 0: 1
1: 0
2: 3
3: 34
4: 308
Right 1187698200 X:21941209-21941231 TCGGGGAGTCCCCGGGCTGCCGG 0: 1
1: 0
2: 1
3: 16
4: 177
1187698182_1187698194 12 Left 1187698182 X:21941157-21941179 CCTGGCCGTCCACCCGCGCTCCC 0: 1
1: 0
2: 3
3: 34
4: 308
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698182 Original CRISPR GGGAGCGCGGGTGGACGGCC AGG (reversed) Intronic