ID: 1187698183

View in Genome Browser
Species Human (GRCh38)
Location X:21941162-21941184
Sequence CGCGTGGGAGCGCGGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 196}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698183_1187698202 30 Left 1187698183 X:21941162-21941184 CCGTCCACCCGCGCTCCCACGCG 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1187698202 X:21941215-21941237 AGTCCCCGGGCTGCCGGGCGCGG 0: 1
1: 0
2: 2
3: 30
4: 280
1187698183_1187698201 25 Left 1187698183 X:21941162-21941184 CCGTCCACCCGCGCTCCCACGCG 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269
1187698183_1187698196 16 Left 1187698183 X:21941162-21941184 CCGTCCACCCGCGCTCCCACGCG 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1187698196 X:21941201-21941223 GCTCCCGCTCGGGGAGTCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 122
1187698183_1187698193 6 Left 1187698183 X:21941162-21941184 CCGTCCACCCGCGCTCCCACGCG 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1187698193 X:21941191-21941213 CCGCCTTCGCGCTCCCGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1187698183_1187698200 24 Left 1187698183 X:21941162-21941184 CCGTCCACCCGCGCTCCCACGCG 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1187698200 X:21941209-21941231 TCGGGGAGTCCCCGGGCTGCCGG 0: 1
1: 0
2: 1
3: 16
4: 177
1187698183_1187698194 7 Left 1187698183 X:21941162-21941184 CCGTCCACCCGCGCTCCCACGCG 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698183_1187698197 17 Left 1187698183 X:21941162-21941184 CCGTCCACCCGCGCTCCCACGCG 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1187698197 X:21941202-21941224 CTCCCGCTCGGGGAGTCCCCGGG 0: 1
1: 0
2: 0
3: 18
4: 123
1187698183_1187698191 5 Left 1187698183 X:21941162-21941184 CCGTCCACCCGCGCTCCCACGCG 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1187698191 X:21941190-21941212 GCCGCCTTCGCGCTCCCGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698183 Original CRISPR CGCGTGGGAGCGCGGGTGGA CGG (reversed) Intronic