ID: 1187698185

View in Genome Browser
Species Human (GRCh38)
Location X:21941164-21941186
Sequence GTCCACCCGCGCTCCCACGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698177_1187698185 -2 Left 1187698177 X:21941143-21941165 CCGCCCTTCCGGGCCCTGGCCGT 0: 1
1: 0
2: 1
3: 11
4: 228
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698180_1187698185 -10 Left 1187698180 X:21941151-21941173 CCGGGCCCTGGCCGTCCACCCGC 0: 1
1: 0
2: 1
3: 35
4: 497
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698170_1187698185 11 Left 1187698170 X:21941130-21941152 CCCGCCGGCCGCGCCGCCCTTCC 0: 1
1: 1
2: 3
3: 42
4: 436
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698175_1187698185 3 Left 1187698175 X:21941138-21941160 CCGCGCCGCCCTTCCGGGCCCTG 0: 1
1: 0
2: 3
3: 37
4: 387
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698178_1187698185 -5 Left 1187698178 X:21941146-21941168 CCCTTCCGGGCCCTGGCCGTCCA 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698174_1187698185 7 Left 1187698174 X:21941134-21941156 CCGGCCGCGCCGCCCTTCCGGGC 0: 1
1: 0
2: 3
3: 31
4: 265
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698171_1187698185 10 Left 1187698171 X:21941131-21941153 CCGCCGGCCGCGCCGCCCTTCCG 0: 1
1: 0
2: 2
3: 40
4: 288
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698169_1187698185 18 Left 1187698169 X:21941123-21941145 CCGGGTGCCCGCCGGCCGCGCCG 0: 1
1: 0
2: 1
3: 61
4: 364
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698168_1187698185 19 Left 1187698168 X:21941122-21941144 CCCGGGTGCCCGCCGGCCGCGCC 0: 1
1: 0
2: 1
3: 43
4: 354
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85
1187698179_1187698185 -6 Left 1187698179 X:21941147-21941169 CCTTCCGGGCCCTGGCCGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 204
Right 1187698185 X:21941164-21941186 GTCCACCCGCGCTCCCACGCGGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698185 Original CRISPR GTCCACCCGCGCTCCCACGC GGG Intronic