ID: 1187698186

View in Genome Browser
Species Human (GRCh38)
Location X:21941166-21941188
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 160}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698186_1187698200 20 Left 1187698186 X:21941166-21941188 CCACCCGCGCTCCCACGCGGGCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1187698200 X:21941209-21941231 TCGGGGAGTCCCCGGGCTGCCGG 0: 1
1: 0
2: 1
3: 16
4: 177
1187698186_1187698193 2 Left 1187698186 X:21941166-21941188 CCACCCGCGCTCCCACGCGGGCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1187698193 X:21941191-21941213 CCGCCTTCGCGCTCCCGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1187698186_1187698196 12 Left 1187698186 X:21941166-21941188 CCACCCGCGCTCCCACGCGGGCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1187698196 X:21941201-21941223 GCTCCCGCTCGGGGAGTCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 122
1187698186_1187698191 1 Left 1187698186 X:21941166-21941188 CCACCCGCGCTCCCACGCGGGCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1187698191 X:21941190-21941212 GCCGCCTTCGCGCTCCCGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 75
1187698186_1187698202 26 Left 1187698186 X:21941166-21941188 CCACCCGCGCTCCCACGCGGGCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1187698202 X:21941215-21941237 AGTCCCCGGGCTGCCGGGCGCGG 0: 1
1: 0
2: 2
3: 30
4: 280
1187698186_1187698203 27 Left 1187698186 X:21941166-21941188 CCACCCGCGCTCCCACGCGGGCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1187698203 X:21941216-21941238 GTCCCCGGGCTGCCGGGCGCGGG 0: 1
1: 1
2: 1
3: 31
4: 312
1187698186_1187698201 21 Left 1187698186 X:21941166-21941188 CCACCCGCGCTCCCACGCGGGCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269
1187698186_1187698194 3 Left 1187698186 X:21941166-21941188 CCACCCGCGCTCCCACGCGGGCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698186_1187698197 13 Left 1187698186 X:21941166-21941188 CCACCCGCGCTCCCACGCGGGCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1187698197 X:21941202-21941224 CTCCCGCTCGGGGAGTCCCCGGG 0: 1
1: 0
2: 0
3: 18
4: 123
1187698186_1187698206 30 Left 1187698186 X:21941166-21941188 CCACCCGCGCTCCCACGCGGGCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1187698206 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG 0: 1
1: 1
2: 4
3: 50
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698186 Original CRISPR AGCCCGCGTGGGAGCGCGGG TGG (reversed) Intronic