ID: 1187698189

View in Genome Browser
Species Human (GRCh38)
Location X:21941177-21941199
Sequence CGAAGGCGGCGAGCCCGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 51}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698189_1187698209 30 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698209 X:21941230-21941252 GGGCGCGGGCGGACCCCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 108
1187698189_1187698194 -8 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698189_1187698196 1 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698196 X:21941201-21941223 GCTCCCGCTCGGGGAGTCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 122
1187698189_1187698200 9 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698200 X:21941209-21941231 TCGGGGAGTCCCCGGGCTGCCGG 0: 1
1: 0
2: 1
3: 16
4: 177
1187698189_1187698193 -9 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698193 X:21941191-21941213 CCGCCTTCGCGCTCCCGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1187698189_1187698203 16 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698203 X:21941216-21941238 GTCCCCGGGCTGCCGGGCGCGGG 0: 1
1: 1
2: 1
3: 31
4: 312
1187698189_1187698206 19 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698206 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG 0: 1
1: 1
2: 4
3: 50
4: 507
1187698189_1187698202 15 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698202 X:21941215-21941237 AGTCCCCGGGCTGCCGGGCGCGG 0: 1
1: 0
2: 2
3: 30
4: 280
1187698189_1187698197 2 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698197 X:21941202-21941224 CTCCCGCTCGGGGAGTCCCCGGG 0: 1
1: 0
2: 0
3: 18
4: 123
1187698189_1187698191 -10 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698191 X:21941190-21941212 GCCGCCTTCGCGCTCCCGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 75
1187698189_1187698201 10 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698189 Original CRISPR CGAAGGCGGCGAGCCCGCGT GGG (reversed) Intronic
903349950 1:22711327-22711349 CGGGGGCGGCGAGCGCGCGTGGG - Intronic
924957687 1:248945017-248945039 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1064048693 10:12042449-12042471 TGGAGGCGGGGAGCCCGCGGTGG - Intronic
1067436985 10:46285077-46285099 CGAAGGCGGCGGGCGCTCGCGGG - Intergenic
1071573758 10:86711604-86711626 AGAGGGCGGGGAGCCCGCGCGGG + Intronic
1076639088 10:131901532-131901554 CGGAGGCGTCGGGCCCGCGGCGG + Intronic
1076963535 10:133786531-133786553 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1078654441 11:13225289-13225311 CTAAGGCGGGGAGCCCACTTAGG + Intergenic
1092256260 12:6928120-6928142 GGGAGGCGGCGAGCCCGGGGAGG + Intronic
1098342956 12:69470555-69470577 GGACGGCCGCGGGCCCGCGTCGG + Intronic
1108648376 13:52452086-52452108 CTAAGGCTGCGTGCCCACGTGGG + Intergenic
1111951854 13:94713781-94713803 AGAAGGCGGCGGGCACGAGTAGG + Intergenic
1113989971 13:114353410-114353432 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1122221000 14:100239122-100239144 GGAAGGCGGCGAGCGGGCGGGGG - Exonic
1126786124 15:52179388-52179410 CGAGCGCGGCGAGCCCGTGTAGG - Intronic
1136535061 16:30894204-30894226 CCAAGGGGGCGGGCCCGGGTCGG - Exonic
1142799736 17:2337630-2337652 CGGAGGCGGCGAGGGCGCGGGGG + Exonic
1147629122 17:41918770-41918792 CGTGGGCACCGAGCCCGCGTCGG + Intronic
1153565615 18:6414752-6414774 GGATGGTCGCGAGCCCGCGTGGG - Intronic
1155461737 18:26090965-26090987 CGAAGGGGGCGGGCCGGCTTGGG - Intronic
1160452085 18:78973271-78973293 CGCAGGGGGCGTCCCCGCGTCGG + Intergenic
1160633383 18:80262845-80262867 CAAAGGCGGCGCGCCCGCGCAGG - Intergenic
1160722173 19:602572-602594 CGAAGGCGGGAAGCCAGGGTGGG - Intronic
1161042543 19:2117668-2117690 CAGAGGCGGGGAGCCCGCGGGGG - Intronic
1161613709 19:5257938-5257960 CGGAGGCGGTGAGCCCGAGGAGG + Intronic
1165479499 19:36054294-36054316 GGCAGGCGGCGAGCGCGGGTGGG - Exonic
1168728745 19:58607242-58607264 CAAAGGCGGCGCGCCGGCGGAGG - Intergenic
931052449 2:58428955-58428977 CGAAGGCGGCGGCCCCTCCTGGG - Intergenic
932599197 2:73112484-73112506 CCAGGGCGCCGGGCCCGCGTCGG + Exonic
936569833 2:113603713-113603735 CAAAGGCGGCGCGCCGGCGGAGG + Intergenic
937956171 2:127422851-127422873 CGGAGGGGGCGCGCCCGGGTGGG - Intronic
946329944 2:219003259-219003281 CGAAGGCCGGGAGCCTGCGAGGG + Exonic
1180014840 21:45075046-45075068 CGAGGGCGCCGAGTCCGCGTGGG + Intronic
1180264220 21:46699310-46699332 CAAAGGCGGCGCGCCGGCGGAGG - Intergenic
1181483715 22:23217835-23217857 TGAAGGCGGGGATCCCGGGTAGG + Intronic
1185430382 22:50807256-50807278 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
959591894 3:108090917-108090939 CGGCGGCGGCGACCCCGCGGCGG - Exonic
962817945 3:139019909-139019931 CGGGAGCGGCGAGCGCGCGTGGG + Exonic
985466789 4:190203974-190203996 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
993500549 5:88661204-88661226 CGAAGGCGGCTGGCCCGCCGCGG - Intergenic
997870012 5:137498644-137498666 CGGAGGCGGGGACCCCGCGGCGG + Intronic
1001382261 5:171312395-171312417 CGAAGGCCGCGGGCCAGCGCCGG + Intergenic
1011603735 6:89081829-89081851 TGAAGGAGGCGAGGCCGGGTGGG + Intronic
1019033099 6:169030546-169030568 GGAAGGCGGGGAGCCCCAGTGGG - Intergenic
1019268063 7:129993-130015 CGAAGGCTGCCAGCCAGCGGCGG + Intergenic
1019417101 7:932773-932795 CGAAGGCGGTGAGCCCAAGGTGG + Intronic
1019577635 7:1745199-1745221 TGAAGGCGGCCAGCCAGCGCAGG - Exonic
1027250786 7:76397590-76397612 CGAAGGCGGCGAGCCCCGCCTGG - Exonic
1030049130 7:105522361-105522383 CGTAGGCTGGGAGTCCGCGTTGG - Intergenic
1036561907 8:9905496-9905518 CGCAGGAGGCGAGCCGGCGCTGG + Intergenic
1049508977 8:143018419-143018441 CGGAGTCGGCGAGCCCGCGGTGG - Intronic
1056078144 9:83062531-83062553 CGAAGGCGACGAGGACGCGGCGG - Exonic
1185456079 X:311521-311543 TGAGGGCAGCGTGCCCGCGTGGG + Exonic
1187698189 X:21941177-21941199 CGAAGGCGGCGAGCCCGCGTGGG - Intronic
1189491391 X:41473933-41473955 CGAAGGCGGCGAGTTCGCGCAGG - Exonic
1192160582 X:68783588-68783610 AGAAGCCGGCGGGCCGGCGTTGG + Intergenic
1192237552 X:69305707-69305729 GGCAGGCGGCGAGGCCGCGCCGG - Intergenic
1192546460 X:72018598-72018620 CGGAGGCGGCGAGCCTGCGAGGG + Intergenic