ID: 1187698190

View in Genome Browser
Species Human (GRCh38)
Location X:21941178-21941200
Sequence GCGAAGGCGGCGAGCCCGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 140}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698190_1187698206 18 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698206 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG 0: 1
1: 1
2: 4
3: 50
4: 507
1187698190_1187698201 9 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269
1187698190_1187698193 -10 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698193 X:21941191-21941213 CCGCCTTCGCGCTCCCGCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1187698190_1187698210 30 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698210 X:21941231-21941253 GGCGCGGGCGGACCCCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1187698190_1187698196 0 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698196 X:21941201-21941223 GCTCCCGCTCGGGGAGTCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 122
1187698190_1187698197 1 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698197 X:21941202-21941224 CTCCCGCTCGGGGAGTCCCCGGG 0: 1
1: 0
2: 0
3: 18
4: 123
1187698190_1187698200 8 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698200 X:21941209-21941231 TCGGGGAGTCCCCGGGCTGCCGG 0: 1
1: 0
2: 1
3: 16
4: 177
1187698190_1187698209 29 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698209 X:21941230-21941252 GGGCGCGGGCGGACCCCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 108
1187698190_1187698202 14 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698202 X:21941215-21941237 AGTCCCCGGGCTGCCGGGCGCGG 0: 1
1: 0
2: 2
3: 30
4: 280
1187698190_1187698194 -9 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698190_1187698203 15 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698203 X:21941216-21941238 GTCCCCGGGCTGCCGGGCGCGGG 0: 1
1: 1
2: 1
3: 31
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698190 Original CRISPR GCGAAGGCGGCGAGCCCGCG TGG (reversed) Intronic