ID: 1187698194

View in Genome Browser
Species Human (GRCh38)
Location X:21941192-21941214
Sequence CGCCTTCGCGCTCCCGCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698188_1187698194 -1 Left 1187698188 X:21941170-21941192 CCGCGCTCCCACGCGGGCTCGCC 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698181_1187698194 13 Left 1187698181 X:21941156-21941178 CCCTGGCCGTCCACCCGCGCTCC 0: 1
1: 0
2: 2
3: 11
4: 188
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698179_1187698194 22 Left 1187698179 X:21941147-21941169 CCTTCCGGGCCCTGGCCGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 204
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698190_1187698194 -9 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698186_1187698194 3 Left 1187698186 X:21941166-21941188 CCACCCGCGCTCCCACGCGGGCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698182_1187698194 12 Left 1187698182 X:21941157-21941179 CCTGGCCGTCCACCCGCGCTCCC 0: 1
1: 0
2: 3
3: 34
4: 308
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698178_1187698194 23 Left 1187698178 X:21941146-21941168 CCCTTCCGGGCCCTGGCCGTCCA 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698180_1187698194 18 Left 1187698180 X:21941151-21941173 CCGGGCCCTGGCCGTCCACCCGC 0: 1
1: 0
2: 1
3: 35
4: 497
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698187_1187698194 0 Left 1187698187 X:21941169-21941191 CCCGCGCTCCCACGCGGGCTCGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698183_1187698194 7 Left 1187698183 X:21941162-21941184 CCGTCCACCCGCGCTCCCACGCG 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698189_1187698194 -8 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1187698177_1187698194 26 Left 1187698177 X:21941143-21941165 CCGCCCTTCCGGGCCCTGGCCGT 0: 1
1: 0
2: 1
3: 11
4: 228
Right 1187698194 X:21941192-21941214 CGCCTTCGCGCTCCCGCTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698194 Original CRISPR CGCCTTCGCGCTCCCGCTCG GGG Intronic