ID: 1187698195

View in Genome Browser
Species Human (GRCh38)
Location X:21941194-21941216
Sequence CTCCCCGAGCGGGAGCGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 78}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698195_1187698211 20 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698211 X:21941237-21941259 GGCGGACCCCCCATGGGACGAGG 0: 1
1: 0
2: 0
3: 7
4: 56
1187698195_1187698210 14 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698210 X:21941231-21941253 GGCGCGGGCGGACCCCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1187698195_1187698218 29 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698218 X:21941246-21941268 CCCATGGGACGAGGGTTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 172
1187698195_1187698201 -7 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269
1187698195_1187698203 -1 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698203 X:21941216-21941238 GTCCCCGGGCTGCCGGGCGCGGG 0: 1
1: 1
2: 1
3: 31
4: 312
1187698195_1187698209 13 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698209 X:21941230-21941252 GGGCGCGGGCGGACCCCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 108
1187698195_1187698206 2 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698206 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG 0: 1
1: 1
2: 4
3: 50
4: 507
1187698195_1187698212 21 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698212 X:21941238-21941260 GCGGACCCCCCATGGGACGAGGG 0: 1
1: 0
2: 0
3: 0
4: 37
1187698195_1187698200 -8 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698200 X:21941209-21941231 TCGGGGAGTCCCCGGGCTGCCGG 0: 1
1: 0
2: 1
3: 16
4: 177
1187698195_1187698202 -2 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698202 X:21941215-21941237 AGTCCCCGGGCTGCCGGGCGCGG 0: 1
1: 0
2: 2
3: 30
4: 280
1187698195_1187698216 28 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698216 X:21941245-21941267 CCCCATGGGACGAGGGTTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698195 Original CRISPR CTCCCCGAGCGGGAGCGCGA AGG (reversed) Intronic