ID: 1187698198

View in Genome Browser
Species Human (GRCh38)
Location X:21941204-21941226
Sequence AGCCCGGGGACTCCCCGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 111}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698198_1187698211 10 Left 1187698198 X:21941204-21941226 CCCGCTCGGGGAGTCCCCGGGCT 0: 1
1: 0
2: 3
3: 15
4: 111
Right 1187698211 X:21941237-21941259 GGCGGACCCCCCATGGGACGAGG 0: 1
1: 0
2: 0
3: 7
4: 56
1187698198_1187698216 18 Left 1187698198 X:21941204-21941226 CCCGCTCGGGGAGTCCCCGGGCT 0: 1
1: 0
2: 3
3: 15
4: 111
Right 1187698216 X:21941245-21941267 CCCCATGGGACGAGGGTTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 86
1187698198_1187698210 4 Left 1187698198 X:21941204-21941226 CCCGCTCGGGGAGTCCCCGGGCT 0: 1
1: 0
2: 3
3: 15
4: 111
Right 1187698210 X:21941231-21941253 GGCGCGGGCGGACCCCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1187698198_1187698209 3 Left 1187698198 X:21941204-21941226 CCCGCTCGGGGAGTCCCCGGGCT 0: 1
1: 0
2: 3
3: 15
4: 111
Right 1187698209 X:21941230-21941252 GGGCGCGGGCGGACCCCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 108
1187698198_1187698206 -8 Left 1187698198 X:21941204-21941226 CCCGCTCGGGGAGTCCCCGGGCT 0: 1
1: 0
2: 3
3: 15
4: 111
Right 1187698206 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG 0: 1
1: 1
2: 4
3: 50
4: 507
1187698198_1187698221 29 Left 1187698198 X:21941204-21941226 CCCGCTCGGGGAGTCCCCGGGCT 0: 1
1: 0
2: 3
3: 15
4: 111
Right 1187698221 X:21941256-21941278 GAGGGTTGCAGGGACTGCGGCGG 0: 1
1: 0
2: 2
3: 24
4: 314
1187698198_1187698212 11 Left 1187698198 X:21941204-21941226 CCCGCTCGGGGAGTCCCCGGGCT 0: 1
1: 0
2: 3
3: 15
4: 111
Right 1187698212 X:21941238-21941260 GCGGACCCCCCATGGGACGAGGG 0: 1
1: 0
2: 0
3: 0
4: 37
1187698198_1187698220 26 Left 1187698198 X:21941204-21941226 CCCGCTCGGGGAGTCCCCGGGCT 0: 1
1: 0
2: 3
3: 15
4: 111
Right 1187698220 X:21941253-21941275 GACGAGGGTTGCAGGGACTGCGG 0: 1
1: 0
2: 3
3: 18
4: 232
1187698198_1187698218 19 Left 1187698198 X:21941204-21941226 CCCGCTCGGGGAGTCCCCGGGCT 0: 1
1: 0
2: 3
3: 15
4: 111
Right 1187698218 X:21941246-21941268 CCCATGGGACGAGGGTTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698198 Original CRISPR AGCCCGGGGACTCCCCGAGC GGG (reversed) Intronic