ID: 1187698201

View in Genome Browser
Species Human (GRCh38)
Location X:21941210-21941232
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 269}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698188_1187698201 17 Left 1187698188 X:21941170-21941192 CCGCGCTCCCACGCGGGCTCGCC 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269
1187698192_1187698201 -4 Left 1187698192 X:21941191-21941213 CCGCCTTCGCGCTCCCGCTCGGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269
1187698183_1187698201 25 Left 1187698183 X:21941162-21941184 CCGTCCACCCGCGCTCCCACGCG 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269
1187698182_1187698201 30 Left 1187698182 X:21941157-21941179 CCTGGCCGTCCACCCGCGCTCCC 0: 1
1: 0
2: 3
3: 34
4: 308
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269
1187698186_1187698201 21 Left 1187698186 X:21941166-21941188 CCACCCGCGCTCCCACGCGGGCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269
1187698187_1187698201 18 Left 1187698187 X:21941169-21941191 CCCGCGCTCCCACGCGGGCTCGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269
1187698189_1187698201 10 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269
1187698190_1187698201 9 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269
1187698195_1187698201 -7 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698201 X:21941210-21941232 CGGGGAGTCCCCGGGCTGCCGGG 0: 1
1: 0
2: 2
3: 24
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type