ID: 1187698202

View in Genome Browser
Species Human (GRCh38)
Location X:21941215-21941237
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 280}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698192_1187698202 1 Left 1187698192 X:21941191-21941213 CCGCCTTCGCGCTCCCGCTCGGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1187698202 X:21941215-21941237 AGTCCCCGGGCTGCCGGGCGCGG 0: 1
1: 0
2: 2
3: 30
4: 280
1187698195_1187698202 -2 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698202 X:21941215-21941237 AGTCCCCGGGCTGCCGGGCGCGG 0: 1
1: 0
2: 2
3: 30
4: 280
1187698188_1187698202 22 Left 1187698188 X:21941170-21941192 CCGCGCTCCCACGCGGGCTCGCC 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1187698202 X:21941215-21941237 AGTCCCCGGGCTGCCGGGCGCGG 0: 1
1: 0
2: 2
3: 30
4: 280
1187698183_1187698202 30 Left 1187698183 X:21941162-21941184 CCGTCCACCCGCGCTCCCACGCG 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1187698202 X:21941215-21941237 AGTCCCCGGGCTGCCGGGCGCGG 0: 1
1: 0
2: 2
3: 30
4: 280
1187698190_1187698202 14 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698202 X:21941215-21941237 AGTCCCCGGGCTGCCGGGCGCGG 0: 1
1: 0
2: 2
3: 30
4: 280
1187698187_1187698202 23 Left 1187698187 X:21941169-21941191 CCCGCGCTCCCACGCGGGCTCGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1187698202 X:21941215-21941237 AGTCCCCGGGCTGCCGGGCGCGG 0: 1
1: 0
2: 2
3: 30
4: 280
1187698186_1187698202 26 Left 1187698186 X:21941166-21941188 CCACCCGCGCTCCCACGCGGGCT 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1187698202 X:21941215-21941237 AGTCCCCGGGCTGCCGGGCGCGG 0: 1
1: 0
2: 2
3: 30
4: 280
1187698189_1187698202 15 Left 1187698189 X:21941177-21941199 CCCACGCGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1187698202 X:21941215-21941237 AGTCCCCGGGCTGCCGGGCGCGG 0: 1
1: 0
2: 2
3: 30
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type