ID: 1187698205

View in Genome Browser
Species Human (GRCh38)
Location X:21941219-21941241
Sequence CCGCCCGCGCCCGGCAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 1, 2: 7, 3: 53, 4: 470}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698205_1187698216 3 Left 1187698205 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG 0: 1
1: 1
2: 7
3: 53
4: 470
Right 1187698216 X:21941245-21941267 CCCCATGGGACGAGGGTTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 86
1187698205_1187698220 11 Left 1187698205 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG 0: 1
1: 1
2: 7
3: 53
4: 470
Right 1187698220 X:21941253-21941275 GACGAGGGTTGCAGGGACTGCGG 0: 1
1: 0
2: 3
3: 18
4: 232
1187698205_1187698218 4 Left 1187698205 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG 0: 1
1: 1
2: 7
3: 53
4: 470
Right 1187698218 X:21941246-21941268 CCCATGGGACGAGGGTTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 172
1187698205_1187698212 -4 Left 1187698205 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG 0: 1
1: 1
2: 7
3: 53
4: 470
Right 1187698212 X:21941238-21941260 GCGGACCCCCCATGGGACGAGGG 0: 1
1: 0
2: 0
3: 0
4: 37
1187698205_1187698222 21 Left 1187698205 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG 0: 1
1: 1
2: 7
3: 53
4: 470
Right 1187698222 X:21941263-21941285 GCAGGGACTGCGGCGGAGCGAGG 0: 1
1: 0
2: 0
3: 23
4: 332
1187698205_1187698211 -5 Left 1187698205 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG 0: 1
1: 1
2: 7
3: 53
4: 470
Right 1187698211 X:21941237-21941259 GGCGGACCCCCCATGGGACGAGG 0: 1
1: 0
2: 0
3: 7
4: 56
1187698205_1187698221 14 Left 1187698205 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG 0: 1
1: 1
2: 7
3: 53
4: 470
Right 1187698221 X:21941256-21941278 GAGGGTTGCAGGGACTGCGGCGG 0: 1
1: 0
2: 2
3: 24
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698205 Original CRISPR CCGCCCGCGCCCGGCAGCCC GGG (reversed) Intronic