ID: 1187698207

View in Genome Browser
Species Human (GRCh38)
Location X:21941220-21941242
Sequence TCCGCCCGCGCCCGGCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 231}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698207_1187698212 -5 Left 1187698207 X:21941220-21941242 CCGGGCTGCCGGGCGCGGGCGGA 0: 1
1: 0
2: 1
3: 23
4: 231
Right 1187698212 X:21941238-21941260 GCGGACCCCCCATGGGACGAGGG 0: 1
1: 0
2: 0
3: 0
4: 37
1187698207_1187698221 13 Left 1187698207 X:21941220-21941242 CCGGGCTGCCGGGCGCGGGCGGA 0: 1
1: 0
2: 1
3: 23
4: 231
Right 1187698221 X:21941256-21941278 GAGGGTTGCAGGGACTGCGGCGG 0: 1
1: 0
2: 2
3: 24
4: 314
1187698207_1187698211 -6 Left 1187698207 X:21941220-21941242 CCGGGCTGCCGGGCGCGGGCGGA 0: 1
1: 0
2: 1
3: 23
4: 231
Right 1187698211 X:21941237-21941259 GGCGGACCCCCCATGGGACGAGG 0: 1
1: 0
2: 0
3: 7
4: 56
1187698207_1187698220 10 Left 1187698207 X:21941220-21941242 CCGGGCTGCCGGGCGCGGGCGGA 0: 1
1: 0
2: 1
3: 23
4: 231
Right 1187698220 X:21941253-21941275 GACGAGGGTTGCAGGGACTGCGG 0: 1
1: 0
2: 3
3: 18
4: 232
1187698207_1187698222 20 Left 1187698207 X:21941220-21941242 CCGGGCTGCCGGGCGCGGGCGGA 0: 1
1: 0
2: 1
3: 23
4: 231
Right 1187698222 X:21941263-21941285 GCAGGGACTGCGGCGGAGCGAGG 0: 1
1: 0
2: 0
3: 23
4: 332
1187698207_1187698218 3 Left 1187698207 X:21941220-21941242 CCGGGCTGCCGGGCGCGGGCGGA 0: 1
1: 0
2: 1
3: 23
4: 231
Right 1187698218 X:21941246-21941268 CCCATGGGACGAGGGTTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 172
1187698207_1187698216 2 Left 1187698207 X:21941220-21941242 CCGGGCTGCCGGGCGCGGGCGGA 0: 1
1: 0
2: 1
3: 23
4: 231
Right 1187698216 X:21941245-21941267 CCCCATGGGACGAGGGTTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698207 Original CRISPR TCCGCCCGCGCCCGGCAGCC CGG (reversed) Intronic