ID: 1187698208

View in Genome Browser
Species Human (GRCh38)
Location X:21941228-21941250
Sequence ATGGGGGGTCCGCCCGCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 140, 4: 218}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698208_1187698218 -5 Left 1187698208 X:21941228-21941250 CCGGGCGCGGGCGGACCCCCCAT 0: 1
1: 0
2: 0
3: 140
4: 218
Right 1187698218 X:21941246-21941268 CCCATGGGACGAGGGTTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 172
1187698208_1187698221 5 Left 1187698208 X:21941228-21941250 CCGGGCGCGGGCGGACCCCCCAT 0: 1
1: 0
2: 0
3: 140
4: 218
Right 1187698221 X:21941256-21941278 GAGGGTTGCAGGGACTGCGGCGG 0: 1
1: 0
2: 2
3: 24
4: 314
1187698208_1187698222 12 Left 1187698208 X:21941228-21941250 CCGGGCGCGGGCGGACCCCCCAT 0: 1
1: 0
2: 0
3: 140
4: 218
Right 1187698222 X:21941263-21941285 GCAGGGACTGCGGCGGAGCGAGG 0: 1
1: 0
2: 0
3: 23
4: 332
1187698208_1187698216 -6 Left 1187698208 X:21941228-21941250 CCGGGCGCGGGCGGACCCCCCAT 0: 1
1: 0
2: 0
3: 140
4: 218
Right 1187698216 X:21941245-21941267 CCCCATGGGACGAGGGTTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 86
1187698208_1187698223 26 Left 1187698208 X:21941228-21941250 CCGGGCGCGGGCGGACCCCCCAT 0: 1
1: 0
2: 0
3: 140
4: 218
Right 1187698223 X:21941277-21941299 GGAGCGAGGCGTGACCCGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 120
1187698208_1187698220 2 Left 1187698208 X:21941228-21941250 CCGGGCGCGGGCGGACCCCCCAT 0: 1
1: 0
2: 0
3: 140
4: 218
Right 1187698220 X:21941253-21941275 GACGAGGGTTGCAGGGACTGCGG 0: 1
1: 0
2: 3
3: 18
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698208 Original CRISPR ATGGGGGGTCCGCCCGCGCC CGG (reversed) Intronic