ID: 1187698210

View in Genome Browser
Species Human (GRCh38)
Location X:21941231-21941253
Sequence GGCGCGGGCGGACCCCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698192_1187698210 17 Left 1187698192 X:21941191-21941213 CCGCCTTCGCGCTCCCGCTCGGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1187698210 X:21941231-21941253 GGCGCGGGCGGACCCCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1187698190_1187698210 30 Left 1187698190 X:21941178-21941200 CCACGCGGGCTCGCCGCCTTCGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1187698210 X:21941231-21941253 GGCGCGGGCGGACCCCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1187698199_1187698210 3 Left 1187698199 X:21941205-21941227 CCGCTCGGGGAGTCCCCGGGCTG 0: 1
1: 0
2: 1
3: 18
4: 128
Right 1187698210 X:21941231-21941253 GGCGCGGGCGGACCCCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1187698198_1187698210 4 Left 1187698198 X:21941204-21941226 CCCGCTCGGGGAGTCCCCGGGCT 0: 1
1: 0
2: 3
3: 15
4: 111
Right 1187698210 X:21941231-21941253 GGCGCGGGCGGACCCCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1187698204_1187698210 -10 Left 1187698204 X:21941218-21941240 CCCCGGGCTGCCGGGCGCGGGCG 0: 1
1: 0
2: 1
3: 37
4: 328
Right 1187698210 X:21941231-21941253 GGCGCGGGCGGACCCCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1187698195_1187698210 14 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698210 X:21941231-21941253 GGCGCGGGCGGACCCCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698210 Original CRISPR GGCGCGGGCGGACCCCCCAT GGG Intronic