ID: 1187698218

View in Genome Browser
Species Human (GRCh38)
Location X:21941246-21941268
Sequence CCCATGGGACGAGGGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187698205_1187698218 4 Left 1187698205 X:21941219-21941241 CCCGGGCTGCCGGGCGCGGGCGG 0: 1
1: 1
2: 7
3: 53
4: 470
Right 1187698218 X:21941246-21941268 CCCATGGGACGAGGGTTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 172
1187698199_1187698218 18 Left 1187698199 X:21941205-21941227 CCGCTCGGGGAGTCCCCGGGCTG 0: 1
1: 0
2: 1
3: 18
4: 128
Right 1187698218 X:21941246-21941268 CCCATGGGACGAGGGTTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 172
1187698198_1187698218 19 Left 1187698198 X:21941204-21941226 CCCGCTCGGGGAGTCCCCGGGCT 0: 1
1: 0
2: 3
3: 15
4: 111
Right 1187698218 X:21941246-21941268 CCCATGGGACGAGGGTTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 172
1187698195_1187698218 29 Left 1187698195 X:21941194-21941216 CCTTCGCGCTCCCGCTCGGGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1187698218 X:21941246-21941268 CCCATGGGACGAGGGTTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 172
1187698207_1187698218 3 Left 1187698207 X:21941220-21941242 CCGGGCTGCCGGGCGCGGGCGGA 0: 1
1: 0
2: 1
3: 23
4: 231
Right 1187698218 X:21941246-21941268 CCCATGGGACGAGGGTTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 172
1187698204_1187698218 5 Left 1187698204 X:21941218-21941240 CCCCGGGCTGCCGGGCGCGGGCG 0: 1
1: 0
2: 1
3: 37
4: 328
Right 1187698218 X:21941246-21941268 CCCATGGGACGAGGGTTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 172
1187698208_1187698218 -5 Left 1187698208 X:21941228-21941250 CCGGGCGCGGGCGGACCCCCCAT 0: 1
1: 0
2: 0
3: 140
4: 218
Right 1187698218 X:21941246-21941268 CCCATGGGACGAGGGTTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187698218 Original CRISPR CCCATGGGACGAGGGTTGCA GGG Intronic