ID: 1187702285

View in Genome Browser
Species Human (GRCh38)
Location X:21974270-21974292
Sequence CTGTAGTTAAAGAGGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187702281_1187702285 17 Left 1187702281 X:21974230-21974252 CCAGAGCAGATGTAAGATAACTA 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 244
1187702280_1187702285 30 Left 1187702280 X:21974217-21974239 CCACAAGAAAGCTCCAGAGCAGA 0: 1
1: 1
2: 1
3: 26
4: 247
Right 1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187702285 Original CRISPR CTGTAGTTAAAGAGGAAAGC AGG Intronic
904606238 1:31699406-31699428 CTGAGGTTGAAGAGGCAAGCAGG + Intronic
905603390 1:39273454-39273476 CTATAATTAAAAAGGAAAACTGG - Intronic
905945720 1:41900186-41900208 CTGAGATTAAAGAGTAAAGCCGG - Intronic
906201577 1:43963856-43963878 CAGTCATTGAAGAGGAAAGCTGG - Intronic
906747090 1:48229561-48229583 CTGTTGAAAAAAAGGAAAGCAGG + Intronic
907586461 1:55622191-55622213 CTGAATTTAATGATGAAAGCAGG + Intergenic
910399586 1:86825405-86825427 CTGTAGTTATGGAGGAATTCAGG + Intergenic
910751700 1:90638025-90638047 CCTTAGTGAAAGAGGAAGGCAGG + Intergenic
911429252 1:97762519-97762541 ATGGAGTTACAGAGAAAAGCAGG - Intronic
911546884 1:99227929-99227951 CAATATTTAAAGGGGAAAGCGGG + Intergenic
911758599 1:101589854-101589876 CTGTACTCTAAAAGGAAAGCAGG - Intergenic
918831978 1:189410330-189410352 CTGTAGTTAAAGAAGACAGAAGG - Intergenic
918852109 1:189705730-189705752 GTCTAGTAAAAGAGGAAGGCTGG - Intergenic
919183885 1:194119233-194119255 TTCTAGTTAAAGAAGAAAGTTGG - Intergenic
919243720 1:194949753-194949775 CTGTGGTTCAAGAGGATAGTTGG - Intergenic
919966199 1:202528016-202528038 CTGGAATCAAAGAGCAAAGCTGG - Intronic
920696404 1:208184338-208184360 CTGTAGCAAAAGAGGAATTCAGG + Intronic
920980070 1:210825645-210825667 TTGTCTTTAAAGAGGAATGCAGG - Intronic
921158595 1:212456965-212456987 CTCCAGATAAAGAGGACAGCAGG - Intergenic
923089943 1:230732432-230732454 CTGTAGTTCACCAAGAAAGCTGG - Intergenic
1063001764 10:1931278-1931300 CTGTTGCTAAGGTGGAAAGCGGG - Intergenic
1065489781 10:26271203-26271225 CTGTATTTAGAGAGGAAAATAGG + Intronic
1065756542 10:28935982-28936004 TTATTGTTAAAGAGGAAAGTGGG + Intergenic
1067690435 10:48498170-48498192 CTGTGGTGAAAGGAGAAAGCTGG + Intronic
1068510680 10:57962107-57962129 ATGTAGTTCCAGAGGAAAGGAGG - Intergenic
1069965328 10:72110486-72110508 CAGAAGTTAAAGAGCAAATCAGG + Intronic
1070237663 10:74646494-74646516 CTGTAGTTAAAGAGAGAAAATGG + Intronic
1070368532 10:75759190-75759212 ATGTAGTTAAACAGGAAATGGGG + Intronic
1072024123 10:91436945-91436967 CTGTAGTTAAAGTGGAATTTCGG + Intronic
1079274824 11:19025498-19025520 CTTAATTTAAAGAGGCAAGCTGG - Intergenic
1079467354 11:20743616-20743638 CTGTGGGGTAAGAGGAAAGCAGG - Intronic
1080026234 11:27618019-27618041 CTGTCCTTTAAGAGAAAAGCTGG + Intergenic
1080504673 11:32900733-32900755 CTTCAGTTAAAGAGAATAGCCGG - Intronic
1080644406 11:34177884-34177906 CTGCAGTTCAGGAGTAAAGCTGG - Intronic
1081026452 11:38020278-38020300 CTGTAGTCATTTAGGAAAGCAGG - Intergenic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1084230872 11:67751695-67751717 CTTTACTTAAAGAGAAATGCTGG + Intergenic
1084645609 11:70455728-70455750 CAGTATTTAAAGGGAAAAGCAGG + Intergenic
1085006495 11:73096238-73096260 TTGTATTTAAAAAAGAAAGCAGG + Intronic
1085458150 11:76677441-76677463 CTGAAGTGAAAAAGGAAAGGAGG + Intergenic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1087276264 11:96163349-96163371 CTGTAGACAAATAGAAAAGCTGG - Intronic
1089894085 11:121909872-121909894 ATGAAGTTAGAGAAGAAAGCTGG - Intergenic
1089936838 11:122373027-122373049 CATTAGTTGAAGAGGAAATCTGG - Intergenic
1091692671 12:2607591-2607613 CTGTATTTACAGTGGAAAGTAGG + Intronic
1093381335 12:18497827-18497849 TTGTAGTTTAAAACGAAAGCTGG - Intronic
1093525412 12:20099499-20099521 GTGTGGATAAAGAGTAAAGCGGG + Intergenic
1093854501 12:24084018-24084040 CTGCAGTGCAAGAGGAAAGGAGG + Intergenic
1094267759 12:28577967-28577989 TTGTATTTAAAGTGGAAAGAGGG + Intronic
1097312777 12:58139309-58139331 CTGTAGTTAAAGGAAAAATCAGG + Intergenic
1097528958 12:60774604-60774626 CTTTAGTTTAAGACGAAAGAGGG + Intergenic
1098070420 12:66668573-66668595 CTCTAGTTAAATAGGAAATTGGG + Intronic
1098556718 12:71826807-71826829 CTGTTACTAAAGAGCAAAGCTGG + Intergenic
1099340074 12:81419926-81419948 CTGTGGGTGAAAAGGAAAGCAGG + Intronic
1100470965 12:94892458-94892480 CTATAATTAAAGAGGAACACTGG - Intergenic
1100910583 12:99356776-99356798 CGGTTTTTAAAGAGTAAAGCAGG - Intronic
1103263357 12:119608623-119608645 TTATATTTAAAGAGCAAAGCTGG + Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1106082925 13:26515464-26515486 CTGAAGTTAAAGAGGCACGAGGG + Intergenic
1106393797 13:29360823-29360845 TTGTACCTAAAGAGGAAAACAGG + Intronic
1107832588 13:44387489-44387511 TTCTGGTCAAAGAGGAAAGCTGG - Intronic
1107969268 13:45625460-45625482 CTGTAGAAAAAAAGTAAAGCTGG - Intergenic
1110070097 13:71164373-71164395 CTCGAATTAAAGAGGAAACCAGG + Intergenic
1110150497 13:72246932-72246954 CTGTACTTTAAAAAGAAAGCAGG + Intergenic
1110560127 13:76902288-76902310 CTGATGGTCAAGAGGAAAGCGGG + Intergenic
1114344300 14:21779663-21779685 AAGAAATTAAAGAGGAAAGCTGG + Intergenic
1115269653 14:31537653-31537675 TTCTAAGTAAAGAGGAAAGCAGG + Intronic
1115629803 14:35232971-35232993 CTGTTGTAAAAGAGGAAGGAGGG - Intronic
1117771751 14:59140567-59140589 CTGTTGTAACAGAGGAAATCTGG + Intergenic
1117886945 14:60374091-60374113 AGGAAGTTAAAGAGGAAATCGGG + Intergenic
1118271694 14:64349116-64349138 ATGTAGTTAATGAAAAAAGCAGG + Intergenic
1120750417 14:88192304-88192326 ATGTACTTAAAGATGACAGCAGG + Exonic
1121081896 14:91115037-91115059 CCGTAGTAAAAGAGGACAGAGGG - Intronic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122762095 14:104036547-104036569 GTCTAGTTAAAAAGGCAAGCAGG - Intronic
1125967976 15:43889522-43889544 CTGCAGTAAAAGAGGCAAACAGG + Intronic
1125995395 15:44155132-44155154 CTGTTGATAAAAAGAAAAGCTGG + Intronic
1126240963 15:46442857-46442879 CTGAAGTTGAAAAAGAAAGCAGG - Intergenic
1126438187 15:48657406-48657428 GTGTAATTAAAGAGGAAAGGAGG + Intergenic
1130401054 15:83554480-83554502 CTGTTGTTTAAGAGCAAGGCTGG - Intronic
1131472408 15:92708607-92708629 TTGAAGTTGAAGAGGGAAGCAGG - Intronic
1132436020 15:101803301-101803323 CAGCAATTAAAGGGGAAAGCTGG - Intergenic
1140973876 16:80040863-80040885 CTGGAGAAAAAGAAGAAAGCGGG - Intergenic
1143117787 17:4590486-4590508 CTGGAGTTTAAGAGAAAAGAAGG - Intronic
1143314601 17:6022759-6022781 CTGTGGTTCATGAGAAAAGCTGG + Intronic
1146783347 17:35696107-35696129 ATGAAGTTAATGAGGAAAGGAGG - Intronic
1147241761 17:39095171-39095193 CTGTATTTTCAGAGGACAGCTGG - Intronic
1147814813 17:43201496-43201518 CTGTGGCTAAAGAGGAAAATGGG + Intronic
1149285505 17:55159580-55159602 CTTTGGTTAAAAAGGAATGCAGG - Intronic
1151878850 17:76882484-76882506 TTTTATTTAAAGAGGAAAACAGG - Intronic
1152875192 17:82782397-82782419 CTGTAATTAAAGAGAGAAGAAGG - Intronic
1156093124 18:33495208-33495230 CTGTAATAAAAGAAGAAAGAGGG + Intergenic
1156410993 18:36828534-36828556 CCGTTGTTACAGAGGAAAGTGGG - Intronic
1157898598 18:51491876-51491898 TTGTAGTTAGAGAGGGAGGCAGG - Intergenic
1159403160 18:67963545-67963567 TTGTTTTTAAAGAGGAAAGTAGG - Intergenic
1162272872 19:9630568-9630590 CCCTATTTACAGAGGAAAGCAGG + Intronic
1162488946 19:10980213-10980235 CTGCAGTGAAACAGGAACGCGGG - Intronic
1164188268 19:22892032-22892054 CTGAAGTTAAAAAAAAAAGCGGG - Intergenic
1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG + Intronic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165592718 19:36984200-36984222 CTCTCGTTAAAGAACAAAGCTGG - Intronic
926622126 2:15056458-15056480 TTTTAGTTAAAGAGGAAATGTGG + Intergenic
926894002 2:17664366-17664388 CTCTAGTTATTGAGGAAAACTGG - Exonic
926928113 2:18008799-18008821 CTGGTATTCAAGAGGAAAGCAGG - Intronic
927098866 2:19771438-19771460 CTTTATTCGAAGAGGAAAGCTGG - Intergenic
927234383 2:20856905-20856927 CTTTACTTAATGAGGAAAGAGGG - Intergenic
930617555 2:53609195-53609217 ATGTAGTTATAGAGGACAGAAGG + Intronic
933073799 2:77896676-77896698 ATGTTTTTAAATAGGAAAGCAGG - Intergenic
935304912 2:101728087-101728109 CTGTACTTAAAGAGGTAACCTGG - Intronic
939929020 2:148208761-148208783 AAGTAGTTGAAGAGAAAAGCTGG - Intronic
940825916 2:158412132-158412154 ATGTAGTGGAAAAGGAAAGCAGG - Intronic
942364508 2:175209379-175209401 CAGGAGTTAAGGAGGAAAGAGGG - Intergenic
942626264 2:177903870-177903892 CTGGAGTTCCAGATGAAAGCAGG + Intronic
943256853 2:185605063-185605085 CAGAAAGTAAAGAGGAAAGCTGG + Intergenic
945226376 2:207535192-207535214 CTGGAGTTAAACAGGAAATGAGG - Intronic
948410895 2:237759784-237759806 CTGTAGTTAAAAAGGATGCCTGG + Intronic
1169465893 20:5837954-5837976 CTGTAGTTACAAAACAAAGCAGG + Intronic
1170311906 20:15001434-15001456 CTAAAGTTTTAGAGGAAAGCTGG - Intronic
1170464022 20:16606555-16606577 CTGTGGTTATAGAAGAATGCTGG + Intergenic
1170959983 20:21016637-21016659 CTGGAGCTACAGAGAAAAGCAGG + Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173660824 20:44732263-44732285 CAGTATTTAAAGGGGAAAGCAGG + Intergenic
1174757055 20:53169527-53169549 ATGTAGTTAAAAAAGAGAGCTGG - Intronic
1175602176 20:60283704-60283726 CTAAAGTTAAAAAGGAAAACTGG + Intergenic
1178428830 21:32501516-32501538 CTTTACTTAAAGAGAAATGCTGG - Intronic
1179217121 21:39377218-39377240 CTAGAGTGAAAGAGGGAAGCAGG + Intergenic
1179399648 21:41071700-41071722 CTGTAGCTTAAGAGGGAGGCAGG - Intergenic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1179968933 21:44823533-44823555 CAGTATTTAAAGAGGAAAAGTGG - Intergenic
1183128465 22:35808938-35808960 GTGAAGTCAAAGAGGTAAGCTGG + Intronic
1185204554 22:49530146-49530168 CTGTAGGTCAAAAGGCAAGCGGG + Intronic
949249363 3:1964200-1964222 CTTTACTAAAAGAGGAAAGTGGG + Intergenic
949298819 3:2559452-2559474 CATTTGTCAAAGAGGAAAGCGGG - Intronic
949862464 3:8518694-8518716 CTGGAGATAAAGATGAGAGCTGG + Intronic
951942662 3:28097619-28097641 CAATAGTAAAAGAGGAAAGGAGG - Intergenic
953721757 3:45362241-45362263 CTGGAGATAAAGAGGAGGGCAGG - Intergenic
954952744 3:54489611-54489633 CTGTAGATAAGGAGCAGAGCTGG + Intronic
955033790 3:55246505-55246527 ATGGATTTAAAAAGGAAAGCTGG + Intergenic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
957597511 3:82287321-82287343 CTATAGTTGAAGAAGAAAGAAGG + Intergenic
958028393 3:88076379-88076401 CTGTACTTAAAGATGAAAATGGG - Intronic
958193116 3:90208627-90208649 CTGTTGTTAAAGAGCAAACCGGG - Intergenic
959872739 3:111347088-111347110 CTTTAGTAAAAATGGAAAGCTGG - Intronic
961879502 3:130050874-130050896 CTTTACTTAAAGAGAAATGCTGG + Intergenic
963133384 3:141877573-141877595 CTGTAATTAAAAAGGAATCCGGG - Intronic
964304902 3:155329294-155329316 CTGGAGCTCAAGAGCAAAGCAGG - Intergenic
964305322 3:155333499-155333521 CTGGAGTTCAAGAACAAAGCAGG - Intergenic
964539008 3:157758172-157758194 CAGTTGTTAAAGAGAAAACCAGG + Intergenic
967317511 3:188163217-188163239 CTGTAGTTCAAATGGAAAGCTGG + Intronic
968991714 4:3917778-3917800 CTTTACTTAAAGAGAAATGCTGG + Intergenic
969390235 4:6887355-6887377 CTGTATTTAAAGGGGAAAAGTGG + Intergenic
971354453 4:25882519-25882541 TTGGAGTTAAAGAGAGAAGCTGG + Intronic
971523342 4:27583556-27583578 CCGTAGTAGAAAAGGAAAGCAGG - Intergenic
971617289 4:28808160-28808182 CAGTAGTTACAGAAGAAAGGAGG + Intergenic
972251116 4:37303394-37303416 CTGAACAAAAAGAGGAAAGCTGG - Intronic
972662591 4:41130609-41130631 ATGTAGTTAGAAAGGAAAGGAGG - Intronic
974651764 4:64763218-64763240 CAGTATTTAAAGGGGAAAGAAGG - Intergenic
975466520 4:74715404-74715426 CTGTAGTGACAGAGTAAAGGGGG - Intergenic
976577424 4:86690194-86690216 CTCTAGTTAAAGAGGGAAAATGG - Intronic
977011995 4:91647920-91647942 TTGTAGGCAAAGAGGAGAGCTGG + Intergenic
978898685 4:113923217-113923239 CTGTAGAGAAAGAGAACAGCAGG - Intronic
979188214 4:117824954-117824976 CTGTTTTCAAAGAGGAAAGGTGG + Intergenic
979814999 4:125089371-125089393 ATGTAGCTGAAGAGTAAAGCAGG + Intergenic
982530628 4:156538209-156538231 CTGTAGTTATAAAGTAAAGCTGG - Intergenic
982551226 4:156802085-156802107 CAGTATTTAAAGGGGAAAGGTGG - Intronic
983558910 4:169082238-169082260 CTGGAGTTAGAGAGAGAAGCAGG - Intergenic
983641638 4:169948891-169948913 CTGAAATTAATGAGGAAATCTGG - Intergenic
984972414 4:185203395-185203417 CTGTAGTTAAACAGCACAGTAGG + Intronic
985191363 4:187376909-187376931 CTCCAGTTAAGGAGGGAAGCAGG + Intergenic
987524819 5:19033687-19033709 AAGTTGTTAGAGAGGAAAGCAGG + Intergenic
989171292 5:38472266-38472288 CTGTTGTCAAAGAGGTAAGAAGG + Intergenic
990535317 5:56715928-56715950 CTGTTGTAAGAGAGGAAAGGAGG + Intergenic
991154656 5:63417521-63417543 CTGATGTTAAAGAGGCAAGAGGG - Intergenic
991400547 5:66246596-66246618 ATGTTGTTAAAGAAGAAGGCTGG + Intergenic
991977155 5:72194738-72194760 CTGAAGTTAAGTAGGAAATCGGG - Exonic
992073608 5:73171477-73171499 TTATAGTTAAAGAGAAAATCTGG + Intergenic
992335338 5:75761828-75761850 CTGTAGTTACAGAGGTAATAGGG - Intergenic
992549838 5:77849934-77849956 CTGTGGCTAAAGATCAAAGCTGG - Intronic
993509815 5:88757580-88757602 CTGTAGTTAATTAGGGAAGGGGG - Intronic
993919233 5:93780001-93780023 TTATATTTAAAGAGAAAAGCAGG + Intronic
994377664 5:99033466-99033488 CTGAAGTAAAACAGGAAAGAGGG - Intergenic
996281230 5:121731419-121731441 CTGTAGTGAAAAGTGAAAGCCGG - Intergenic
996566132 5:124881155-124881177 CTGTAGCTAAAGGGGAACGTGGG - Intergenic
996976907 5:129445802-129445824 CAGTAGTCAAAAAGGAAAGTGGG - Intergenic
997255247 5:132423452-132423474 GTGAAGTAGAAGAGGAAAGCAGG + Intronic
997866485 5:137468221-137468243 CTGCAGTTAAAGAGAACAGAGGG + Intronic
999639970 5:153662695-153662717 CAGAAGTTAAACAGCAAAGCTGG + Intronic
1000224869 5:159250778-159250800 CAGTTGTTACAGAGGAAATCTGG + Intergenic
1001268710 5:170294730-170294752 CTGTAGATAAAGGGGATACCAGG - Intronic
1006683859 6:35815869-35815891 ATGTGGTTAAAGATGAAAACAGG + Intronic
1007542366 6:42659757-42659779 AAGAAGTTAAAGTGGAAAGCAGG + Exonic
1007906795 6:45469853-45469875 CTCTAGTTAGAGATGAAAGGTGG - Intronic
1008276426 6:49549532-49549554 CTGTGGTTAAAGAGGACGGGTGG + Intergenic
1008996970 6:57670406-57670428 CTATAGTTAAAAAAGAAAGATGG - Intergenic
1009185484 6:60569732-60569754 CTATAGTTAAAAAAGAAAGATGG - Intergenic
1009440934 6:63677284-63677306 GTGTAGATAAAGAAGAAAGATGG + Intronic
1010928309 6:81770265-81770287 CTAATGTTAAAGGGGAAAGCTGG + Intergenic
1011100932 6:83721440-83721462 CTGTAGTTAATGCTGAAAGATGG - Intergenic
1012677403 6:102134415-102134437 CTGTAGCTTAAGAAAAAAGCAGG - Intergenic
1014997321 6:128165332-128165354 CTGTATGTAAAGAGGAAAAAGGG - Intronic
1015062956 6:128989863-128989885 CTGTCTATAAACAGGAAAGCAGG - Intronic
1015486208 6:133772851-133772873 CTGTGGTTAAAGAAAAAAGATGG + Intergenic
1017605242 6:156126546-156126568 CTGTAATTAGAAAGGGAAGCAGG - Intergenic
1021218283 7:17943469-17943491 CAGTTGTTACAGAGGAAACCTGG + Intergenic
1021612400 7:22471020-22471042 CTCAATTTAAAGATGAAAGCAGG - Intronic
1022220133 7:28306394-28306416 CTATAGTTTCAGAGGGAAGCTGG - Intronic
1023677894 7:42650052-42650074 CTGGAGTTGAAGAGAAAAGGAGG + Intergenic
1024303347 7:47904694-47904716 CTATACTTTAAGAGGAAGGCGGG + Intronic
1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG + Intergenic
1025083850 7:56006814-56006836 CAGCTGTTAAAGAGGACAGCAGG + Intergenic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1030084729 7:105806528-105806550 CTGCAGTCCAAGAGGCAAGCTGG + Intronic
1030946086 7:115722481-115722503 TTGTAGATAAACAGGAAAGAGGG + Intergenic
1031570783 7:123356610-123356632 ATGTCATTAAAGAAGAAAGCAGG - Intergenic
1031913331 7:127540195-127540217 GTGTGGCTAGAGAGGAAAGCAGG + Intergenic
1033763873 7:144466074-144466096 GTGGAGCCAAAGAGGAAAGCAGG - Intronic
1033867271 7:145706295-145706317 CTGAAGTTAAAGAGAAAATGAGG + Intergenic
1036051701 8:5206075-5206097 CTTTGGTGAGAGAGGAAAGCTGG + Intergenic
1038428169 8:27478824-27478846 CTGTGGTTACAGAAGAAAACAGG + Exonic
1038559744 8:28562807-28562829 CTGCAGTTACAGAGGAATGGAGG + Exonic
1038703880 8:29876208-29876230 CTGTGGTTAAAAAGGTCAGCAGG + Intergenic
1039043121 8:33426714-33426736 ATGTAGTCATAGAGGAGAGCTGG - Intronic
1039622304 8:39009527-39009549 CTGTAGAAAAGGAGGAAAACAGG - Intronic
1040752715 8:50729709-50729731 CTGTATGTAAAGAGGAAGGGAGG + Intronic
1040770773 8:50972543-50972565 ATTTAGGAAAAGAGGAAAGCTGG + Intergenic
1042966096 8:74354149-74354171 CTATAGTTGAAGAGGTAATCTGG - Intronic
1043499945 8:80842978-80843000 CTTGAGTTGAAGATGAAAGCAGG - Intronic
1044857961 8:96494788-96494810 ATGCAGTCAAACAGGAAAGCTGG - Intronic
1045755885 8:105541338-105541360 CAGTTGTTAAATAGCAAAGCTGG + Intronic
1050338801 9:4615376-4615398 CTGTGGTTAAGACGGAAAGCAGG - Intronic
1050615880 9:7401308-7401330 CTGTATTTAAAGAGGAGAGAGGG - Intergenic
1051585536 9:18722978-18723000 CTGTAGTCAAATAGAAAAGTTGG - Intronic
1051934349 9:22427057-22427079 ATGTAGTTAAAGAGGAGAGCAGG + Intergenic
1052686314 9:31762198-31762220 CAATATTTAAAGGGGAAAGCAGG + Intergenic
1055769807 9:79704934-79704956 CTGCAGATAAAAAGGCAAGCTGG - Intronic
1056748282 9:89323999-89324021 ATGTAGCTAAAAAGGAAAGCAGG - Intronic
1056780426 9:89545163-89545185 CTGAAGGCAAATAGGAAAGCTGG + Intergenic
1059212542 9:112527446-112527468 ATGAAGTTGAAGAAGAAAGCAGG + Intronic
1059610459 9:115886978-115887000 CTGAAATAAAAGAAGAAAGCGGG - Intergenic
1059612539 9:115914841-115914863 CTATAGAAAAAGAGGAGAGCTGG + Intergenic
1059801118 9:117750485-117750507 CTGTACTTGGAGAGGAAAGATGG - Intergenic
1186103441 X:6180934-6180956 CTTTACTTAAAGAAAAAAGCAGG - Intronic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1187971022 X:24658644-24658666 TTGAAGTGAAAGAGGAAGGCAGG - Intronic
1188200198 X:27287239-27287261 CTGCAGTTAAAGAGTTAACCTGG + Intergenic
1188440455 X:30210757-30210779 CGGTATTTAAAGAGGAAAAGGGG - Intergenic
1188748517 X:33876719-33876741 CTATATTTAAAAAGGAAAGTAGG - Intergenic
1188908901 X:35821858-35821880 CTGTTATTGATGAGGAAAGCAGG - Intergenic
1189378734 X:40486281-40486303 CTGAAGAAAAAGAGGAAAGAAGG - Intergenic
1190239344 X:48645266-48645288 TTATCGTTAAAAAGGAAAGCAGG - Intergenic
1191870978 X:65744755-65744777 CTGCAGTTAAAGAACAAGGCAGG + Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1193289269 X:79752899-79752921 CTGCAGTTAAAGAGAGAACCAGG - Intergenic
1194866209 X:99071127-99071149 CTCTAGTTAAACAGGAAATGAGG - Intergenic
1195588099 X:106589371-106589393 TTGTAGTTAAAGAGTACACCTGG + Intergenic
1199729752 X:150620356-150620378 CAGTAGTATAAGGGGAAAGCTGG - Intronic