ID: 1187704420

View in Genome Browser
Species Human (GRCh38)
Location X:21995245-21995267
Sequence CAAGTTGCTCATATTGCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187704420_1187704421 -10 Left 1187704420 X:21995245-21995267 CCTATGGCAATATGAGCAACTTG No data
Right 1187704421 X:21995258-21995280 GAGCAACTTGAAAACTCCTAAGG No data
1187704420_1187704426 28 Left 1187704420 X:21995245-21995267 CCTATGGCAATATGAGCAACTTG No data
Right 1187704426 X:21995296-21995318 ACAGCTTGGTGTGGTGTGTGTGG No data
1187704420_1187704425 19 Left 1187704420 X:21995245-21995267 CCTATGGCAATATGAGCAACTTG No data
Right 1187704425 X:21995287-21995309 AGGTAGCTAACAGCTTGGTGTGG No data
1187704420_1187704424 14 Left 1187704420 X:21995245-21995267 CCTATGGCAATATGAGCAACTTG No data
Right 1187704424 X:21995282-21995304 AGTGCAGGTAGCTAACAGCTTGG No data
1187704420_1187704427 29 Left 1187704420 X:21995245-21995267 CCTATGGCAATATGAGCAACTTG No data
Right 1187704427 X:21995297-21995319 CAGCTTGGTGTGGTGTGTGTGGG No data
1187704420_1187704422 -1 Left 1187704420 X:21995245-21995267 CCTATGGCAATATGAGCAACTTG No data
Right 1187704422 X:21995267-21995289 GAAAACTCCTAAGGAAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187704420 Original CRISPR CAAGTTGCTCATATTGCCAT AGG (reversed) Intergenic
No off target data available for this crispr