ID: 1187704422

View in Genome Browser
Species Human (GRCh38)
Location X:21995267-21995289
Sequence GAAAACTCCTAAGGAAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187704420_1187704422 -1 Left 1187704420 X:21995245-21995267 CCTATGGCAATATGAGCAACTTG No data
Right 1187704422 X:21995267-21995289 GAAAACTCCTAAGGAAGTGCAGG No data
1187704416_1187704422 27 Left 1187704416 X:21995217-21995239 CCGATGTATGACAGAATTTATGG No data
Right 1187704422 X:21995267-21995289 GAAAACTCCTAAGGAAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187704422 Original CRISPR GAAAACTCCTAAGGAAGTGC AGG Intergenic
No off target data available for this crispr