ID: 1187704424

View in Genome Browser
Species Human (GRCh38)
Location X:21995282-21995304
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187704420_1187704424 14 Left 1187704420 X:21995245-21995267 CCTATGGCAATATGAGCAACTTG No data
Right 1187704424 X:21995282-21995304 AGTGCAGGTAGCTAACAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187704424 Original CRISPR AGTGCAGGTAGCTAACAGCT TGG Intergenic
No off target data available for this crispr