ID: 1187704427

View in Genome Browser
Species Human (GRCh38)
Location X:21995297-21995319
Sequence CAGCTTGGTGTGGTGTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187704423_1187704427 0 Left 1187704423 X:21995274-21995296 CCTAAGGAAGTGCAGGTAGCTAA No data
Right 1187704427 X:21995297-21995319 CAGCTTGGTGTGGTGTGTGTGGG No data
1187704420_1187704427 29 Left 1187704420 X:21995245-21995267 CCTATGGCAATATGAGCAACTTG No data
Right 1187704427 X:21995297-21995319 CAGCTTGGTGTGGTGTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187704427 Original CRISPR CAGCTTGGTGTGGTGTGTGT GGG Intergenic
No off target data available for this crispr