ID: 1187710948

View in Genome Browser
Species Human (GRCh38)
Location X:22053804-22053826
Sequence CAGAACAATAAGATGAAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187710944_1187710948 27 Left 1187710944 X:22053754-22053776 CCAATATTTTGTGAAGAAATGCA 0: 1
1: 0
2: 1
3: 73
4: 758
Right 1187710948 X:22053804-22053826 CAGAACAATAAGATGAAGTAGGG 0: 1
1: 0
2: 0
3: 31
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187710948 Original CRISPR CAGAACAATAAGATGAAGTA GGG Intronic
901329464 1:8394066-8394088 CAGAAAGACAAGATGAAGGATGG + Intronic
902475626 1:16684115-16684137 TAGAACATTAAGTTGAAGAATGG - Intergenic
904410325 1:30321107-30321129 CAGAACAATCAGGAGAAGCATGG - Intergenic
905545459 1:38794980-38795002 CAAAAAAATAAGATGAATTGAGG + Intergenic
905845836 1:41230704-41230726 CTGAACAAATAGATGAATTAGGG + Intronic
907190635 1:52645033-52645055 AAGAAGAAGAAGAAGAAGTAAGG + Intronic
908064818 1:60391439-60391461 AAGAAAAATAAAAGGAAGTAGGG + Intergenic
908919453 1:69171536-69171558 TAGAACAAGAAGATGAAGGAAGG + Intergenic
909430865 1:75586170-75586192 TAGAACAAAAAGGAGAAGTAAGG + Intronic
911321202 1:96415656-96415678 TAGAAGAAGAAGAAGAAGTAAGG + Intergenic
915630441 1:157150134-157150156 CAGAACAAAATGACAAAGTAAGG + Intergenic
915980050 1:160414886-160414908 CAGAATCAGAAGGTGAAGTATGG + Intronic
916449859 1:164910170-164910192 CAGAACAAAGGGATGAAGGAAGG - Intergenic
916498685 1:165368084-165368106 CAGAACAACAGGTAGAAGTAAGG - Intergenic
916998315 1:170326379-170326401 AAGAGCAATAAGTTGAAGTTTGG - Intergenic
917707266 1:177647238-177647260 CAGGACAAACAGATGAAGAAAGG - Intergenic
919645693 1:200092488-200092510 CAGATCAATATGGTGAAGTATGG - Intronic
919646859 1:200103897-200103919 CAGAACAAGAGGGAGAAGTATGG + Intronic
920040866 1:203095634-203095656 GACAACAATAGGATGAAGAATGG + Intronic
920586132 1:207163167-207163189 AAGAGCAATAAAATGAAGTTGGG + Intergenic
921871827 1:220149303-220149325 AACAATAATAAGCTGAAGTATGG - Exonic
923329264 1:232907475-232907497 AAGAAGAAGAAGAAGAAGTAAGG + Intergenic
923506025 1:234607797-234607819 CAGAACCAGAAGGTGAAGTCGGG - Exonic
1063419838 10:5903153-5903175 GAGAACAAAAAGAGGGAGTAGGG + Exonic
1063802046 10:9591073-9591095 AAGTACAATAAAATGAGGTATGG + Intergenic
1063957245 10:11278807-11278829 CACAACAACCTGATGAAGTAGGG + Intronic
1064635638 10:17363596-17363618 CATATTAATAAGATAAAGTATGG - Intronic
1065603377 10:27392195-27392217 CTGAACAATAAAATGAGGAAAGG - Intergenic
1065726700 10:28674478-28674500 CAGAACCATTAGATAAAGTGCGG + Intergenic
1068352524 10:55866961-55866983 CATAACAATGAAATCAAGTATGG + Intergenic
1069212161 10:65775862-65775884 CAGAATAATAAAATAAAGAAAGG + Intergenic
1069296544 10:66851975-66851997 GACAACAATGGGATGAAGTATGG + Intronic
1069963529 10:72094345-72094367 CAAAACAGTAATATGAAGGAAGG + Intergenic
1070649782 10:78226865-78226887 CAAAACAACAAGATGAGGAATGG - Intergenic
1071990369 10:91095570-91095592 CAGAGTAATAAGATGAAGTTTGG + Intergenic
1072007535 10:91268045-91268067 CAAAACAATAAGGTTAAATATGG - Intronic
1074905287 10:117857174-117857196 GAGCACAATAAAATGGAGTATGG + Intergenic
1075468117 10:122667097-122667119 GAGACCAATAATCTGAAGTAGGG - Intergenic
1075803990 10:125172227-125172249 CACAACAATCATATGAGGTATGG + Intergenic
1075830466 10:125406886-125406908 GAGAAAAATAAGGGGAAGTAAGG - Intergenic
1078287685 11:9974408-9974430 CAGACCAATTTCATGAAGTAGGG + Intronic
1078397073 11:10990709-10990731 CAAAACAGTAAGATGAAGTGAGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079302255 11:19288376-19288398 CTGAGCAATAAGATGAAGGCAGG - Intergenic
1079430581 11:20385807-20385829 CTGAACAATAAGGGTAAGTAAGG - Intergenic
1079722474 11:23835386-23835408 CATTACAATAATATGAAGTTGGG - Intergenic
1080037677 11:27726164-27726186 GAGATGAATAAGAGGAAGTATGG + Intergenic
1080534232 11:33206019-33206041 TAGAACAACAAGATGGAGAAAGG + Intergenic
1081341349 11:41931880-41931902 CAAACCAATAAAATGCAGTATGG - Intergenic
1082213466 11:49535757-49535779 CAGAACTCTAAGATAAAATATGG + Intergenic
1082766848 11:57175795-57175817 CAGAGCAAAAAAATGAAGTATGG + Intergenic
1085916693 11:80897650-80897672 CAAAACAATGAGAGAAAGTACGG - Intergenic
1086048201 11:82557955-82557977 CTGAACAAAAACATGAAGCAGGG + Intergenic
1086636143 11:89088677-89088699 CAGAACTCTAAGATAAAATATGG - Intergenic
1087366293 11:97223851-97223873 CACATTAATAAGATGAAGGATGG + Intergenic
1087808978 11:102589828-102589850 AATAAAAATAAGATGAAATAGGG - Intronic
1088032726 11:105271008-105271030 CAGAAAAATTAGATGACGTTGGG - Intergenic
1088180780 11:107107275-107107297 CAGACCAATAACATGCAGTGAGG + Intergenic
1088348660 11:108860018-108860040 CAAAACAAGAAGAAGAAGAAAGG - Intronic
1088946298 11:114516831-114516853 CAAAACTAGAAGAAGAAGTAGGG - Intergenic
1090357742 11:126151246-126151268 CAGAACAGAAAGATGAAGTTTGG - Intergenic
1090818960 11:130323815-130323837 TAGAACAAAAAGGTGAAGGAAGG + Intergenic
1091040061 11:132269177-132269199 TAGAACAAGAAAATAAAGTATGG + Intronic
1091051083 11:132373177-132373199 AAGATAAATAACATGAAGTAGGG - Intergenic
1091584748 12:1809823-1809845 CAGGACAAGAACATGAAGTGGGG + Intronic
1093059448 12:14588086-14588108 GAGAAAAATAAGAAGAAGAAGGG - Intergenic
1093099514 12:15010879-15010901 TAGAAGAATAAGATGATGTGTGG + Intergenic
1093122304 12:15285727-15285749 AAGAAATATAAGATGAAATATGG + Intronic
1093702922 12:22242914-22242936 CAGAACAAAAAGATTAGTTAGGG - Intronic
1093726301 12:22514097-22514119 CAGAACAATAAAATAAGGTAGGG - Intronic
1094050028 12:26209008-26209030 AAGAAGAATAAAATGAAGGAGGG - Intronic
1097618866 12:61915780-61915802 TAGAACAAAAAGGTGAAGGAAGG - Intronic
1097815978 12:64073967-64073989 CATAAGAATAACATGATGTAAGG - Intronic
1099049999 12:77770457-77770479 CAGAAGAATATTATGAAGTAGGG + Intergenic
1099381967 12:81965797-81965819 CAATAAAATAAGATGAAGTATGG + Intergenic
1101907532 12:108838933-108838955 GAAGAAAATAAGATGAAGTAAGG - Intronic
1102741913 12:115215447-115215469 CAGTACAATAACATGCTGTATGG - Intergenic
1102838185 12:116087690-116087712 CAGACCAGTAAGAGGAAGGAAGG - Intronic
1102998770 12:117369304-117369326 CAGCACAATCCTATGAAGTAGGG - Intronic
1103068778 12:117923008-117923030 AAGTACAAAAATATGAAGTAAGG - Intronic
1103770469 12:123318940-123318962 CACAACACCAAGATGAACTAAGG + Intronic
1104296100 12:127515021-127515043 CAGAAGAACATGATGTAGTATGG + Intergenic
1104343795 12:127977460-127977482 CAGGACACTAAGAAGAAGCAAGG + Intergenic
1107192297 13:37604122-37604144 GAGAACAAGAAGAAGAAATATGG - Intergenic
1107711788 13:43157810-43157832 CAGAACACTGAGATGGAGTTAGG + Intergenic
1107825106 13:44322001-44322023 TAGAACAAAAAGGTGAAGAAGGG - Intergenic
1108009679 13:45992790-45992812 CAGAACAAAAAGGTGAAGGAAGG + Intronic
1108364517 13:49696588-49696610 CAGATGCATAAGATGAAGAAAGG - Intergenic
1109281012 13:60355839-60355861 CATAACAATAAGCTATAGTAAGG + Intergenic
1109743085 13:66582022-66582044 CAGAATGATATCATGAAGTATGG - Intronic
1109909034 13:68885929-68885951 TAGAACAAAAAGGTGAAGGAAGG + Intergenic
1110143303 13:72158087-72158109 CAGAAGAATAACATCAAGTCAGG + Intergenic
1110454080 13:75670200-75670222 CAGAAAAGTATGCTGAAGTAGGG + Intronic
1112801414 13:103113855-103113877 CTGAACAATAGTATGAATTAAGG + Intergenic
1112928384 13:104705372-104705394 CACAGGAAGAAGATGAAGTATGG - Intergenic
1115125904 14:29993529-29993551 TAGAACAAAAAGTTGAAGGAAGG - Intronic
1115742503 14:36403341-36403363 CAGAACAAAAAGGTGAAGGAGGG + Intergenic
1115947596 14:38679693-38679715 CAGAATGATAAAATGAACTATGG - Intergenic
1116129830 14:40840624-40840646 CTTAACAATAATATGAAGCATGG + Intergenic
1116141195 14:40996237-40996259 CATAAAAATTAGATGAAGTGTGG - Intergenic
1117045283 14:51807281-51807303 CAGAACTATCAGATGAGTTATGG + Intergenic
1117103530 14:52375308-52375330 CAGAACAATAACAAGCAGTGAGG - Intergenic
1118989146 14:70782149-70782171 CAGAACAGTGTGATGTAGTAGGG - Intronic
1119039476 14:71259927-71259949 TAGAATAATAAAATGAAGGATGG + Intergenic
1119149243 14:72343150-72343172 CAGAACTATAAGATAATGAATGG - Intronic
1119289876 14:73487226-73487248 AAGAAAAATGAGATGAATTAGGG + Intronic
1119543574 14:75456328-75456350 CAGAACACGGAGATGAAGAAGGG - Intronic
1119627862 14:76197296-76197318 AAGAACAAAAAGATGAAAGAGGG - Intronic
1119702183 14:76762637-76762659 CAGTGCAATAAGGTGAATTAGGG - Exonic
1119935086 14:78585110-78585132 GAGAAAAATAAGAAGAAATAGGG + Intronic
1120088194 14:80299549-80299571 CAGTACAATAAGATTAAGAAGGG - Intronic
1120314950 14:82879883-82879905 CAAAACATTAAGATGATTTATGG + Intergenic
1120656593 14:87197630-87197652 CTGAACTATAAGATAAATTATGG - Intergenic
1121418991 14:93799107-93799129 GAGAAAAATAAAATAAAGTAAGG - Intergenic
1122731055 14:103798699-103798721 CAAAAAAATAAAATAAAGTAAGG - Intronic
1122759471 14:104011721-104011743 CACAACAATAAGAACAAGAAAGG - Intronic
1124592298 15:31063987-31064009 CTGAAGAATAAGATGATGAAAGG + Intronic
1124838370 15:33217875-33217897 CAGAAAAATAAAAACAAGTAAGG + Intergenic
1125188667 15:36963669-36963691 CACAACAATAAAATGAAGATAGG - Intronic
1125242432 15:37591201-37591223 CAGAAAAAAGAGAGGAAGTAGGG - Intergenic
1126500931 15:49343732-49343754 CAGAACAATAAGTTGAAAGCAGG - Intronic
1127568001 15:60212455-60212477 GAAAAAAATAAGATGAAATAAGG + Intergenic
1127853040 15:62931787-62931809 CAAAACAAGAAGAGGAAATAAGG - Intergenic
1128095608 15:64952231-64952253 GAGAAGAATAAGAAGAAGAAAGG - Intronic
1128957105 15:71959853-71959875 AAAAAAAAAAAGATGAAGTATGG + Intronic
1129880631 15:79004125-79004147 CAGAACAATAAGCTCCTGTACGG - Exonic
1130161537 15:81405885-81405907 CAGGACAATTAAATGTAGTATGG + Intergenic
1130732485 15:86511800-86511822 CAAAACAAAAGGATGAAGTAGGG + Intronic
1130779105 15:87016275-87016297 CAGAACAATGATCTGAAATATGG - Intronic
1131501894 15:92975993-92976015 CAGAGCAATATTATGAAGTGGGG - Intronic
1131516417 15:93080583-93080605 CAGAGCAAGAGGATGGAGTAGGG - Intronic
1131612152 15:93976544-93976566 TAGAACAAAAAGATAAAGAAAGG - Intergenic
1131956743 15:97743991-97744013 CTGAACAAAAAGACTAAGTAAGG - Intergenic
1134329395 16:13236625-13236647 CAGAAAAAGAAGAGGAAGGAAGG - Exonic
1135764502 16:25165855-25165877 CACAACAATGCTATGAAGTAGGG - Intronic
1138062378 16:53905289-53905311 CACAACAAAATGATGAAGTCAGG - Intronic
1138925681 16:61588098-61588120 TAGAACAATATGAAGAAGTAAGG - Intergenic
1139054045 16:63159422-63159444 AATAAGAACAAGATGAAGTAAGG + Intergenic
1140052929 16:71498852-71498874 AAAAAAAAAAAGATGAAGTAGGG - Intronic
1141371355 16:83489088-83489110 CACAAGAAAAAGATGAAGCATGG + Intronic
1141857904 16:86697136-86697158 CAGAAAAAGAACATCAAGTATGG - Intergenic
1143181974 17:4989001-4989023 CAGAACAGAAAGGTGAAGAATGG - Intronic
1145744006 17:27299675-27299697 CAGAAAAGTATGATGAAGTTAGG + Intronic
1146699261 17:34940543-34940565 CAGAGCAAAAAGAAGAAATATGG - Exonic
1147269648 17:39259619-39259641 GAGAACACTGAGAGGAAGTAAGG - Intronic
1148530023 17:48381025-48381047 CTGAAAAATAAAATCAAGTATGG + Intronic
1149602556 17:57902822-57902844 CACAACAATCCTATGAAGTAGGG + Intronic
1150464534 17:65380925-65380947 CAGTTCAATAAGATGTAGTTGGG - Intergenic
1155487965 18:26367484-26367506 TAGAACAAAAAGATAAAGAAAGG - Intronic
1156296827 18:35799796-35799818 TAGAACAAAAAGGTGGAGTAAGG + Intergenic
1156723261 18:40096216-40096238 CATTAAAATATGATGAAGTAGGG + Intergenic
1159028873 18:63210877-63210899 CAGAACAATGAGATGGTGAATGG - Intronic
1159817567 18:73094731-73094753 CAGAACAAAAAGGTGAAAGAAGG + Intergenic
1160234041 18:77071513-77071535 CAGAACAGAAAGATGAGGAAGGG + Intronic
1161461796 19:4402175-4402197 AAGAACAATAAAACGAAGTCTGG - Intergenic
1161639777 19:5414469-5414491 CAGAATTATAAGATGAAGAATGG - Intergenic
1161658101 19:5528363-5528385 AAGAAAAATAAGAAGAAGAAAGG + Intergenic
1162038971 19:7957987-7958009 CAGGAAAATGAGATCAAGTAGGG - Intergenic
1163952243 19:20599894-20599916 CTAAACAAAAACATGAAGTAGGG - Intronic
1163964157 19:20728504-20728526 CTAAACAAAAACATGAAGTAGGG + Intronic
1164427958 19:28159761-28159783 GTGAACAATAACATAAAGTATGG + Intergenic
1166328289 19:42064597-42064619 CAGATCAGTAAGAGGAAGAATGG - Intronic
1168227564 19:55007259-55007281 AAGAAAAATAAAATGAAATAGGG + Intergenic
1168673670 19:58260583-58260605 CAGAAGAATAAGAATAAGCAGGG - Intronic
925070430 2:962551-962573 AAAAATAATTAGATGAAGTAAGG + Intronic
926017287 2:9465045-9465067 AAAAAGAATTAGATGAAGTATGG + Intronic
926071388 2:9895775-9895797 AACAACAATAAGAATAAGTAAGG + Intronic
926804385 2:16692242-16692264 CTGAATAATAAAATGAAGAAAGG + Intergenic
927361374 2:22238101-22238123 CAGACCAGTAAGAGGTAGTATGG + Intergenic
927733479 2:25497082-25497104 CAGAACAATCACATGACGAAGGG + Intronic
929042625 2:37760369-37760391 CAGAAAAATAAAATGTGGTAAGG + Intergenic
929042797 2:37761779-37761801 CAGAAAAATAAAATGTGGTAAGG + Intergenic
929374080 2:41262952-41262974 AAGAAGAAGAAGAAGAAGTAAGG - Intergenic
929583054 2:43096169-43096191 CAGTACAGTAACATGGAGTATGG + Intergenic
930212967 2:48662176-48662198 AACAACAATAAGACAAAGTAGGG - Intronic
930428270 2:51239534-51239556 CAAAACAAAAACATGAAGTAAGG - Intergenic
930576033 2:53149879-53149901 CAGAATGATGAGATGAATTAAGG + Intergenic
931173233 2:59827212-59827234 TAGAACAACATGATGGAGTAGGG - Intergenic
932455430 2:71846632-71846654 AAAAACAATAAGATGAAGAAAGG - Intergenic
933078522 2:77959304-77959326 CAGATCAATAAGAAAGAGTATGG - Intergenic
933236645 2:79871556-79871578 CAGAACAAAAAGGTGGAGGAAGG - Intronic
933430876 2:82177159-82177181 CAGAACTGTAAGGTGAAGTAAGG - Intergenic
935224254 2:101039326-101039348 CAGAATAATAACATGGAGTTAGG + Intronic
935634524 2:105239840-105239862 CAGAAAATTGAGATGAAGAAGGG + Intergenic
935831351 2:107004087-107004109 CAGAACAATAAGTTTATGTTAGG + Intergenic
936043064 2:109164482-109164504 CAGAAAAATAAAATTAAATAGGG - Intronic
936849755 2:116881648-116881670 TAGAACAAAAAGGTGAAGGAAGG - Intergenic
937471798 2:122180319-122180341 TAGAAAAATAAGATGTATTAGGG + Intergenic
937937040 2:127254452-127254474 CAGAACAAAAGGATGGAGGAAGG - Intergenic
939881438 2:147635851-147635873 CTGAACAATTACATGAAGTGAGG - Intergenic
940089625 2:149901035-149901057 CAGAACATTAAGTTGAATGAAGG - Intergenic
941577750 2:167255686-167255708 CTGAAAACTAAGATGAAATAAGG - Intronic
941834722 2:170003953-170003975 CAGAACATTTTGATGAAGTAAGG + Intronic
942195263 2:173511460-173511482 CAGTACAATAACATGCTGTATGG + Intergenic
942886766 2:180934941-180934963 CAAAACAACAAGATGAAATTTGG - Intergenic
943395263 2:187325619-187325641 CAGAACACAAAGACGAAGGATGG - Intergenic
943402899 2:187438320-187438342 CATAACAATACAATGAGGTAAGG + Intronic
944173688 2:196806194-196806216 CAAAAAAATAAGAACAAGTATGG - Intronic
944187504 2:196965761-196965783 CACAAAGATAAGATGAAGGATGG - Intergenic
944340441 2:198590073-198590095 CACAACAAAAAGATTAAATAAGG - Intergenic
944845048 2:203659740-203659762 CAGGACAAGAAGAGAAAGTAGGG + Intergenic
944931429 2:204524188-204524210 TAGAACAAAAAGGTGAAGGAAGG - Intergenic
946069732 2:217023678-217023700 TAGAACAAAAAGATGAAGGAAGG - Intergenic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1171303419 20:24084135-24084157 CAGAACAATATGCTGCAGGATGG - Intergenic
1172760708 20:37319292-37319314 CAGAACAAAAAGAGGAAGGTTGG - Intergenic
1173072739 20:39785221-39785243 CAAAACAATCATATGAAGAAGGG + Intergenic
1174754559 20:53145008-53145030 TAAAACAATAAAATGAAGCAGGG + Intronic
1174898389 20:54474766-54474788 CTATACAATAAGATGAAGAAGGG - Intergenic
1177226472 21:18263780-18263802 AAAAAGAAGAAGATGAAGTAAGG - Intronic
1177560484 21:22744486-22744508 CAGAAGACTAAGAAGAAGCAAGG + Intergenic
1177752255 21:25298743-25298765 CAGAACACACAGAAGAAGTAGGG + Intergenic
1177933373 21:27313849-27313871 CAGAAAAATAAGACAAAGAAGGG - Intergenic
1177965608 21:27722714-27722736 CAGAATGTTAAAATGAAGTAAGG + Intergenic
1179376867 21:40857465-40857487 TAGAACAAAAAGAAGAAGGAAGG - Intergenic
1184579768 22:45408116-45408138 AATAATAATAAGATGAAGGAAGG - Intronic
1203294807 22_KI270736v1_random:31864-31886 CAGAAAAATAAAATGTGGTAAGG + Intergenic
1203294982 22_KI270736v1_random:33270-33292 CAGAAAAATAAAATGTGGTAAGG + Intergenic
949177398 3:1081747-1081769 AAGAATTATAAGATGAAATAAGG - Intergenic
949618321 3:5781380-5781402 TAGAACAAAAAGATTAAGGAAGG - Intergenic
949677036 3:6467365-6467387 TAGAAGAATAAAATGAAGGAGGG + Intergenic
950002924 3:9671142-9671164 GAGAACAAGAAGGTGAAGTTTGG + Exonic
950876851 3:16283339-16283361 CAGAACCATCAGATGATTTAGGG + Intronic
951391202 3:22106292-22106314 CACAACACTTGGATGAAGTAAGG + Intronic
953207973 3:40848803-40848825 CAGATAAAAAAGGTGAAGTATGG + Intergenic
954513010 3:51144462-51144484 CAGAAGAAAAATATGAAGGATGG - Intronic
955308108 3:57854985-57855007 CAGTACAATAACATGCTGTATGG - Intronic
956702950 3:71974655-71974677 CACAACAATCCGATGAGGTAGGG - Intergenic
956871069 3:73418704-73418726 GAGAACAAGAAAATGAAGTCAGG - Intronic
957878139 3:86175624-86175646 AAGAACAATAACAGGAAGTAGGG - Intergenic
958190776 3:90181499-90181521 CACAACAATAAAAAGAAATAAGG + Intergenic
958412969 3:93840677-93840699 CACAACAATAAAAAGAAATAAGG + Intergenic
958767957 3:98393822-98393844 CAGAACATTAAGATGCTGTTAGG + Intergenic
958781075 3:98543214-98543236 CATAAGAATAAGATGAATTTTGG + Intronic
958787016 3:98607589-98607611 AAGAAAAATAAGATGAACAATGG + Intergenic
960109899 3:113835823-113835845 CAGAACACTAATATTAAGCAAGG - Intronic
960628576 3:119704897-119704919 CAGTACAATAACATGCTGTATGG + Intronic
960920726 3:122745389-122745411 CAGCAAAAAAAGATGAAATATGG + Intronic
962174687 3:133140772-133140794 CAGAAAATTAAAATGAAGTCTGG + Intronic
962347261 3:134627248-134627270 CAAAACAATAGGAAGAAGTATGG + Intronic
962665804 3:137652437-137652459 AAGATCAATAAGCTGAAGGATGG - Intergenic
963270590 3:143282280-143282302 CAGAAAAATAAGATTTACTAAGG + Intronic
963390398 3:144655848-144655870 CAAAACCAAAATATGAAGTAAGG + Intergenic
963613120 3:147497488-147497510 CAGAACAATAAGAGAAAGGCAGG + Intronic
963637382 3:147816091-147816113 CAAAACATTAAGTTGAAATATGG - Intergenic
963753929 3:149213676-149213698 AAGATCAATAAGATGAAAGAAGG - Intronic
964021347 3:152016125-152016147 CAGTACAATAAGATAAATAAAGG - Intergenic
965124569 3:164609067-164609089 CAGAACAAGAAAATGACTTACGG - Intergenic
966753339 3:183343832-183343854 CACAACAATAGCATGAAGAACGG + Intronic
966869173 3:184278743-184278765 TAGAAGAATAAGAGGAAGGAAGG - Intronic
967143250 3:186582155-186582177 GTGAACATTAAGATGGAGTAAGG - Intronic
967767247 3:193294474-193294496 AAGAGAAATAAGATGAAGTGAGG - Intronic
968795416 4:2700499-2700521 AAGAAAAATAAGAAGAAGAAAGG + Exonic
970291687 4:14579678-14579700 TAGAACAAAAAGATAAAGGAAGG - Intergenic
970310991 4:14782367-14782389 CAGATGAATAAGTTGATGTATGG + Intergenic
971629712 4:28974731-28974753 CAGAAGAAAAAGGTGAAGGAAGG - Intergenic
972675274 4:41254535-41254557 AAGAAGAAGAAGAAGAAGTAGGG - Intergenic
972791709 4:42378538-42378560 CTGAACAATAAGATTAATTTAGG + Intergenic
973165195 4:47068898-47068920 GAGCACAATAAAATGAGGTATGG + Intronic
975499484 4:75069125-75069147 CAGAAGAATAAGATGAAAATAGG + Intergenic
976324247 4:83752659-83752681 TAGAACAAAAAGGTGAAGGAAGG + Intergenic
978811022 4:112849950-112849972 TAGAACAAAAAGGTGAAGGAAGG + Intronic
981030809 4:140123788-140123810 CTGAATAATAAAATGAAGTTGGG + Intronic
981056004 4:140362273-140362295 AAGAAGAAGAAGAAGAAGTAAGG - Intronic
981494639 4:145377583-145377605 TAAGAAAATAAGATGAAGTAAGG - Intergenic
982064557 4:151642069-151642091 CAGAAAAGTAAGTTGAAATAAGG + Intronic
982334089 4:154214584-154214606 TGGAACAAAAAGATGAAGAAAGG - Intergenic
982418685 4:155167713-155167735 CAGAAAACTAAGGTGAAGTGAGG + Intergenic
984051739 4:174872888-174872910 CAGAACAAAAAGGTGAAGGAAGG + Intronic
984549645 4:181145203-181145225 CAGTACAATAAGAAAATGTAGGG - Intergenic
984595857 4:181667330-181667352 CAGAGGAATAACATGAAGAAAGG - Intergenic
984872855 4:184342621-184342643 CAGAACAGTAAGATTCTGTAAGG - Intergenic
984891490 4:184498118-184498140 CAGAACAAGAAGCTGAGGAATGG + Intergenic
986154259 5:5158127-5158149 GAGAAAAATAAGGTGTAGTATGG - Intronic
987071965 5:14346191-14346213 CAGAACCAGAAGATCAAGGAAGG + Intronic
987173151 5:15279768-15279790 CAGTGCAATAAGAAGAAGTTAGG - Intergenic
988004535 5:25391700-25391722 CAGACTATTAAGTTGAAGTAAGG - Intergenic
988335321 5:29900066-29900088 CAGAATCATAAAATGAAATATGG - Intergenic
988698916 5:33653015-33653037 CAGTACAATAAGATAAGGAAAGG - Intronic
989526511 5:42459700-42459722 CAGAACAATATTATGATGCAGGG + Intronic
989739350 5:44751895-44751917 CAGAACAATAGTATATAGTATGG - Intergenic
990490776 5:56300844-56300866 CAAAACAATCCTATGAAGTAGGG - Intergenic
991310295 5:65232664-65232686 CAGAACAATAATAAGAAGAGAGG + Intronic
992657945 5:78929103-78929125 CAGAACAGAAAGATGAAGTCTGG - Intronic
992948375 5:81832237-81832259 TAGAACAAAAAGATGGAGCAAGG - Intergenic
993856504 5:93082795-93082817 CAGAACAAATGGATGAAGAATGG - Intergenic
995364015 5:111333940-111333962 CAGACCAAAAAGTTGACGTAAGG + Intronic
995805153 5:116043669-116043691 TAGAAAAATAAAAGGAAGTAAGG + Intronic
996198105 5:120635086-120635108 CAGACCAATAACAAGCAGTAAGG + Intronic
996414993 5:123200888-123200910 CATAACAATGACATGAAGTGTGG - Intergenic
996927108 5:128840754-128840776 GAAAACCATAAGATGAAGTTAGG + Intronic
996944153 5:129046548-129046570 TAGAAAAAAAAGATGAAGGAAGG - Intergenic
997341795 5:133150994-133151016 AGGAAGAATAAGATGAAATATGG - Intergenic
997798687 5:136838119-136838141 CAGAAAAATATGAAGAAGAAAGG - Intergenic
998186558 5:139984403-139984425 ATGAACATTAAGATCAAGTAAGG + Intronic
998646094 5:144063927-144063949 CACAACAATCTTATGAAGTAGGG + Intergenic
998672506 5:144369405-144369427 AATACAAATAAGATGAAGTAGGG + Intronic
1001395563 5:171417484-171417506 CTGAACAATTTCATGAAGTAGGG - Intergenic
1001466478 5:171971449-171971471 TAGGACAAAAAGATGAAGTCAGG - Intronic
1003648227 6:7934018-7934040 CAGAACCATAAAGGGAAGTAAGG - Intronic
1004308531 6:14523067-14523089 TAGAACAAGAAGATGAAGGAAGG - Intergenic
1004909928 6:20273127-20273149 CAGAAGAATCACATGAAGTCAGG - Intergenic
1007131543 6:39479365-39479387 CAAAACAAAAACATGAAGTGGGG - Intronic
1008078352 6:47169398-47169420 TAGAACAAAAAGATGGAGTAAGG - Intergenic
1008136241 6:47780444-47780466 CAGAATCATAAGATGAAGGTTGG - Intergenic
1008385845 6:50888934-50888956 CACATCAAGAAGGTGAAGTAGGG + Intergenic
1008607050 6:53150592-53150614 AAGTACAATAAGATCAAGCAGGG - Intergenic
1008733209 6:54508552-54508574 AAGATCAATAAAATGAGGTATGG + Intergenic
1008787842 6:55191079-55191101 AAGACCAATAAGAGGAATTAGGG + Intronic
1008832087 6:55777543-55777565 AAGAACATTAAAATAAAGTATGG + Intronic
1010407428 6:75521017-75521039 CAGAACTATAAGGTCAAGGAAGG - Intergenic
1011131206 6:84053313-84053335 AAGGAAAATAAGATGAAGTCTGG - Intronic
1011312723 6:85998234-85998256 CAGAAAAATAAAATGAAGGAAGG + Intergenic
1014987755 6:128032737-128032759 TAGATCAATAACATGAAGAAAGG + Intronic
1015001000 6:128215583-128215605 CAGAAGAATAAAAAAAAGTATGG - Intronic
1015096465 6:129419593-129419615 CAAAAATATAAAATGAAGTAAGG - Intronic
1015445166 6:133295653-133295675 CAGGACAATAAAATCTAGTAAGG + Intronic
1015752349 6:136573205-136573227 TAGAACAAAAAGATGGAGAAAGG + Intronic
1016408628 6:143758367-143758389 CAGTATAATACCATGAAGTATGG - Intronic
1018240914 6:161773821-161773843 CAGAAAAAGAAGAAGAAGAAGGG + Intronic
1018382859 6:163275279-163275301 CAAAAAAATAAGAGGAAGAAGGG - Intronic
1018537546 6:164837546-164837568 CAGAACAATAAGTTTCAGAATGG - Intergenic
1020377590 7:7505463-7505485 CAGAACAAAAAGATGCAGATGGG - Intronic
1021940294 7:25672444-25672466 CAGAAAAAAAAGATAAAGAAAGG - Intergenic
1023092600 7:36630932-36630954 CACAACAATAAAATGAGGTAAGG - Intronic
1023235721 7:38084102-38084124 CAGAACAATCAAATTAAATATGG - Intergenic
1024012702 7:45283647-45283669 TAGAACAAAAAGGTGAAGCAAGG - Intergenic
1024401589 7:48929627-48929649 TAGAACAAAAAGTTGAAGGAAGG + Intergenic
1024525032 7:50340776-50340798 CATAACACTAAGATTAAGTAAGG - Intronic
1025804064 7:64812621-64812643 CAGAACAATAAGCTGCTCTATGG - Intronic
1027521461 7:79214191-79214213 AAGAACAATAAAATGCAGTTTGG - Intronic
1030166630 7:106562110-106562132 TAGAACAAAAAGGTGAAGGAAGG + Intergenic
1030561786 7:111096169-111096191 CACAACAATCTGGTGAAGTAGGG + Intronic
1031267039 7:119594103-119594125 CAGAATAAGAAGAAGAAGTTGGG + Intergenic
1031656092 7:124357659-124357681 CAGAACAAGAAGAAGATGAAGGG - Intergenic
1032767981 7:135018506-135018528 CATAAAAATAAGATTAAGTGGGG - Intronic
1032826231 7:135571218-135571240 TTGAACAATGAGATGAAGTCAGG - Exonic
1033502291 7:141964210-141964232 GTGAACAAAAACATGAAGTAGGG - Intronic
1034589115 7:152124546-152124568 TAGAACAAAAAGGTGAAGGAAGG + Intergenic
1034753469 7:153592419-153592441 CAGAACAAAAAGGTGGAATAAGG - Intergenic
1034846594 7:154451794-154451816 CAGAACCAAAAGGTGAAGCAAGG - Intronic
1036064454 8:5363419-5363441 AAGAACAACAAGAGGAAGTCTGG - Intergenic
1036526203 8:9537162-9537184 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1037337961 8:17810040-17810062 CAGAACAATAACAAGTAGTGAGG + Intergenic
1037365259 8:18115501-18115523 CAGAACAGAAAGGTGAAGAAAGG - Intergenic
1038118636 8:24586576-24586598 TAGAACAATAAGATAGAGGAAGG + Intergenic
1038425941 8:27463838-27463860 CAGAACTGCAAGATGAAGTTTGG - Exonic
1038838147 8:31151687-31151709 CAGAAGAGGAAAATGAAGTAGGG + Intronic
1039308201 8:36286944-36286966 CAGAAGAATCAGTTGAACTAGGG + Intergenic
1041993639 8:64026314-64026336 AAGAAGAAAAAGATGAAGAAAGG - Intergenic
1042460688 8:69062139-69062161 CAGAAAAATAAGAGGAATTTGGG + Intergenic
1042753162 8:72180289-72180311 AAGAACAAAAAGGAGAAGTAGGG - Intergenic
1042765535 8:72317043-72317065 AAGAACAAAAAGGAGAAGTAGGG - Intergenic
1042788724 8:72579813-72579835 CAGAATAAGAAGATAGAGTAAGG - Intronic
1042856640 8:73274150-73274172 CAAAAAAAAAAGATGAAATATGG - Intergenic
1043777436 8:84287491-84287513 TAGAAGAATAAAATGAAGAAGGG + Intronic
1044439927 8:92210947-92210969 CTGAACAAGAAGAAGAAGAATGG - Intergenic
1045578667 8:103453959-103453981 CAAAAGAATAAGGTGAAGGATGG + Intergenic
1045629062 8:104095260-104095282 CAGAAAACTAAGAAGAAGCAAGG - Intronic
1046012790 8:108570874-108570896 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1046035841 8:108840369-108840391 CAGAACAAAAAGGTGGAGGAAGG - Intergenic
1047066823 8:121293261-121293283 CAGAATAAAAGGATGAAGAAAGG + Intergenic
1047277762 8:123418515-123418537 GAGAAAAATAAGATAAAGGATGG + Intronic
1047448421 8:124940141-124940163 CACAAGAATAAGATCAAGAAAGG - Intergenic
1047640495 8:126814950-126814972 CTGAACAAAATGATGAAGCAAGG - Intergenic
1048083691 8:131155692-131155714 AAGAAGAAAAAGATGAAGTCCGG + Intergenic
1050127232 9:2369976-2369998 GCAAACAATAAGAGGAAGTAAGG + Intergenic
1051032559 9:12699392-12699414 AAGAAAAATAAGATGAGGTAGGG - Intronic
1051288036 9:15515853-15515875 CAAAGGAATAAGATGAAGCAGGG - Intergenic
1051602439 9:18888779-18888801 CGGCACAAAAAGATGAAGAAAGG + Intronic
1053532038 9:38892026-38892048 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054204263 9:62116435-62116457 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054634100 9:67471929-67471951 GAGAACAAAAAGATGGAGGAAGG - Intergenic
1055517802 9:77050791-77050813 GAGAAAGATAAGATGAAGAAAGG + Intergenic
1059593953 9:115695666-115695688 AACAACAATTAGATGAAATAAGG - Intergenic
1059647740 9:116283988-116284010 CATAACAATCATATGAAGTCAGG - Intronic
1060805514 9:126573471-126573493 AAGAAGAAGAAGAAGAAGTAAGG - Intergenic
1061934959 9:133852361-133852383 CAGAAGAATAAAAAGAAGGAAGG + Intronic
1186070769 X:5817341-5817363 CAGATCAATGAAATGAATTAAGG + Intergenic
1186200760 X:7153148-7153170 CAGAACAATGAGATGATAAAGGG - Intergenic
1187090282 X:16088947-16088969 CAGAACAATACTCAGAAGTATGG - Intergenic
1187389380 X:18875806-18875828 CAGAAAAATGACATGAATTAGGG + Intergenic
1187475957 X:19611210-19611232 CATAAGACTAAGATGAAGCATGG - Intronic
1187534481 X:20126806-20126828 TAGAACATTAAGTTGAAGAATGG - Exonic
1187710948 X:22053804-22053826 CAGAACAATAAGATGAAGTAGGG + Intronic
1188814219 X:34691508-34691530 CAAAACTATAAGATGAGGCAAGG - Intergenic
1188879305 X:35472269-35472291 CAGAACACCAAGCCGAAGTAGGG + Intergenic
1189244467 X:39552776-39552798 CAGCACAATAAAATGAAGGCAGG - Intergenic
1189804026 X:44717737-44717759 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1190851704 X:54250666-54250688 CAGAAAAATAAGATATAGGAAGG + Intronic
1191679022 X:63822711-63822733 CCAAACAAAAATATGAAGTAGGG - Intergenic
1192743907 X:73919845-73919867 CAGAACAAGAAGGTGGAATAAGG + Intergenic
1192929307 X:75788315-75788337 CAGAACAATAATACCAAGTGTGG - Intergenic
1193775256 X:85633912-85633934 CAGTACTATATGATGAAATAAGG - Intergenic
1193826221 X:86230656-86230678 CAGACCAATAAGAAGCAGTGAGG - Intronic
1194176792 X:90660666-90660688 CAAAAGTATAAGATGAAGTGAGG - Intergenic
1194626871 X:96235568-96235590 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1197057500 X:122138504-122138526 CAGAACAAATTGATGAAGTCTGG + Intergenic
1197330458 X:125147735-125147757 GAGAAAAATAAAATGAAGCAGGG - Intergenic
1197837244 X:130708565-130708587 CAGAAAAATATAATGTAGTAAGG - Intronic
1198716458 X:139562777-139562799 CAGAACATAGGGATGAAGTAAGG + Exonic
1199042624 X:143131498-143131520 AAAAACAAAAAGATGATGTATGG + Intergenic
1199818247 X:151419252-151419274 AGGAACAATGAGATGAACTATGG + Intergenic
1200523417 Y:4241516-4241538 CAAAAGTATAAGATGAAGTGAGG - Intergenic
1200739670 Y:6840017-6840039 CAGTACAGTAAAATGATGTATGG + Intergenic
1201054319 Y:9973829-9973851 CCAAAAAATAAGATGAAGAAAGG + Intergenic
1201719944 Y:17085403-17085425 CAGAAGAAGAACAGGAAGTATGG - Intergenic
1201950913 Y:19562879-19562901 TAGAAATATAAGATGAAGCAGGG + Intergenic