ID: 1187711207

View in Genome Browser
Species Human (GRCh38)
Location X:22056389-22056411
Sequence CATGACCAAACAGACTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187711207 Original CRISPR CATGACCAAACAGACTTAGA AGG (reversed) Intronic
900970251 1:5988721-5988743 CATGACCAGGCAGCCTGAGAGGG + Intronic
903310083 1:22448625-22448647 CAGGAGGAAACAGACTTAGAGGG - Intergenic
903513670 1:23895422-23895444 CATGAGCAAATAGATTCAGAGGG + Intronic
905550631 1:38835457-38835479 CATCACCAAACAGGCTGAAAAGG + Intergenic
906235909 1:44209602-44209624 AATCACTAAACAAACTTAGATGG - Intergenic
906673077 1:47673317-47673339 TATGACAAAACAGACCTACAGGG - Intergenic
908974208 1:69878483-69878505 GATGAAGAAACAGACTTAGGTGG + Intronic
909527580 1:76644067-76644089 CAAGAGAAAACAGACTAAGAGGG - Intergenic
911879450 1:103216794-103216816 CATAACCAAACTGACTTTGCTGG - Intergenic
912398143 1:109364904-109364926 GATGACAAAAAAGACTTAGGAGG + Intronic
915014533 1:152720589-152720611 CATGAACAAGCAGACTGAGCTGG + Intergenic
921888472 1:220329803-220329825 CATGGCAAACCAGATTTAGATGG - Intergenic
923871187 1:237995746-237995768 GATGACAAAACAGACTGAGGTGG - Intergenic
924038565 1:239960447-239960469 AATCACCAAAAAGAATTAGAGGG - Intergenic
924726181 1:246673239-246673261 CAGCACAAAACAGACTAAGATGG + Intergenic
1064123127 10:12636646-12636668 AATGAGGAAACAGACTGAGAGGG + Intronic
1065928235 10:30455624-30455646 TAAAACCAAGCAGACTTAGAAGG - Intronic
1066170941 10:32844791-32844813 CATCACAAAACAGAATTTGAAGG - Intronic
1068125154 10:52830524-52830546 TGTGACCAAATAGACTTAGCTGG + Intergenic
1068738122 10:60437800-60437822 GATGAAGAAACAGACTTAAAAGG + Intronic
1069434803 10:68371217-68371239 CAAGACCAAACTGGCTAAGATGG + Intronic
1072968495 10:99995589-99995611 CATGACCAAACAGGCTTGTTGGG + Intronic
1075831818 10:125418539-125418561 GCTGTCCAAACAGACTAAGATGG - Intergenic
1076403803 10:130199677-130199699 CATGTCCAGAGGGACTTAGAAGG + Intergenic
1079915978 11:26369126-26369148 CATACCCACACAGACTTACATGG - Intronic
1080729637 11:34936273-34936295 TATGCCCAAACAGACTTGGTTGG - Intronic
1083584924 11:63849833-63849855 GATGAGCAAACAGACACAGAGGG - Intronic
1088047654 11:105473044-105473066 CATGGCCAAATAAACTGAGACGG - Intergenic
1089828358 11:121300590-121300612 CCTGACCAAAAATACTTAAAAGG + Intronic
1093602831 12:21050987-21051009 CATGACTAAACACAGCTAGAAGG - Intronic
1095183737 12:39177501-39177523 CTTGAGGAAACAGACTCAGAAGG - Intergenic
1096361764 12:50993877-50993899 CATTACCCAAAAGACTGAGATGG + Intronic
1097290953 12:57914521-57914543 GATGAAGACACAGACTTAGAGGG + Intergenic
1099513659 12:83569205-83569227 TCTGACTAAACAGACTTAGTAGG + Intergenic
1099864646 12:88264541-88264563 CATGACCAGACTGACTCAGTGGG - Intergenic
1100227604 12:92574598-92574620 CTTGCCCAAAAAGACTTACAAGG + Intergenic
1103439369 12:120951370-120951392 CATGAGGAAACAGGCTCAGAGGG + Intergenic
1107173031 13:37366195-37366217 CATGAGAAAACAGGCCTAGAAGG + Intergenic
1116936466 14:50745553-50745575 TATGACAAAACAGACTTTCAGGG + Intronic
1117715530 14:58576106-58576128 GATGACAACACAGACTCAGAAGG - Intergenic
1118910607 14:70059238-70059260 AATGACCAATCACACTGAGAAGG + Intronic
1121848993 14:97202183-97202205 GATGGCCAAAGAGATTTAGATGG - Intergenic
1125425018 15:39539935-39539957 CAGGAACCAACAGACATAGATGG + Intergenic
1125903152 15:43367822-43367844 CATTACCAAACTGGCTGAGAAGG + Intronic
1128041805 15:64581419-64581441 CCTGACCAAAAAAACTTAAAAGG - Intronic
1128236223 15:66069202-66069224 CAGGACCAAACAGACTTGGACGG - Intronic
1128666935 15:69545197-69545219 CATGAACAGACAGACACAGAAGG + Intergenic
1128865688 15:71114057-71114079 CTTGATCAAACAGATTTTGATGG - Intronic
1132917621 16:2360952-2360974 TATCAGCAAAAAGACTTAGAAGG + Intergenic
1133455753 16:5940969-5940991 GATGAGGAAACAGACTCAGAAGG - Intergenic
1134194027 16:12144691-12144713 CAGCACAAAACAGACTGAGACGG + Intronic
1135474146 16:22758829-22758851 CATACCTAAACATACTTAGAAGG - Intergenic
1136942624 16:34603285-34603307 CATCACCAAATAGAATCAGAAGG - Intergenic
1137094912 16:36242152-36242174 CATCATCAAATAGAATTAGATGG - Intergenic
1138523371 16:57586310-57586332 CAAGACCAGACTGACTAAGATGG - Intronic
1140682005 16:77394220-77394242 CATAAACAAACACACTTAAATGG - Intronic
1143237482 17:5415488-5415510 AATGAGGAAACAGATTTAGAAGG + Intronic
1143354855 17:6319342-6319364 CATAAACAAACAGACTTAACTGG + Intergenic
1144848346 17:18231553-18231575 GATGAGCACACAGACTTGGAGGG - Intronic
1149564614 17:57632180-57632202 CATGACCAAACAGGCTTGTTGGG + Intronic
1149644702 17:58231847-58231869 CATGACCTAACAGACTCAATTGG - Intronic
1150469021 17:65420124-65420146 TAGAACCAAACAGAGTTAGAAGG + Intergenic
1152784643 17:82241450-82241472 CATGAGCGGACAGAGTTAGAGGG - Intronic
1153711288 18:7802214-7802236 CCTGAGCAAACAGAGTCAGAAGG - Intronic
1156694273 18:39748100-39748122 CAACACAAAACAGACTAAGAGGG + Intergenic
1161489121 19:4552235-4552257 TCTGACCAAAGGGACTTAGAGGG + Intronic
1162867299 19:13557943-13557965 CATGACCACACAGAATTGCAAGG - Intronic
1163540396 19:17905713-17905735 CAAAACAAAACAGACTTTGACGG - Intergenic
1163932797 19:20413839-20413861 CATGACCAGCCTGACTAAGATGG + Intergenic
932444952 2:71774147-71774169 AATGACCATATATACTTAGAAGG + Intergenic
934781692 2:96973306-96973328 TGTGAACAAACAGACTTACAGGG - Intronic
939125064 2:138167690-138167712 CATCTACAAAAAGACTTAGATGG + Intergenic
939700173 2:145381571-145381593 CCACACCAAACTGACTTAGAAGG + Intergenic
940850572 2:158684390-158684412 CATGATCAAACTGGCTTACAAGG + Intergenic
943239675 2:185366353-185366375 CATGAGCAAGAAGACATAGAAGG + Intergenic
943395795 2:187331470-187331492 CATGAGTAAAAAGACTAAGAGGG - Intergenic
948601256 2:239108603-239108625 CAGGACCAGGCAGACTTTGAGGG - Intronic
948773871 2:240269960-240269982 CATGAGCAAACATACTTTGCTGG + Intergenic
1169376182 20:5068267-5068289 CATGACCATACCTAGTTAGAAGG + Intronic
1175240614 20:57545576-57545598 CATGATCAGACAGTCTGAGATGG + Intergenic
1175295351 20:57904636-57904658 CATGGCCATACCGACTTATAAGG - Intergenic
1178537992 21:33426078-33426100 CCTGAACAAATAGACTTACATGG + Intronic
1179187375 21:39095336-39095358 CATGACCACACAGCCTACGAGGG + Intergenic
1184964959 22:47964963-47964985 CCTGGCCAGAAAGACTTAGAGGG - Intergenic
1185209433 22:49561276-49561298 CAGAACAAAACAGACTAAGACGG + Intronic
950095076 3:10324318-10324340 CATTACAAAACAGACTTAGGGGG + Exonic
951001561 3:17566786-17566808 CTTGAATAAACAAACTTAGAAGG + Intronic
952521482 3:34162975-34162997 CATGAATAAACAGAATAAGATGG + Intergenic
954935437 3:54322485-54322507 AATGACCAAACAGGCTTGGCAGG + Intronic
956311394 3:67884600-67884622 CATGTACAAAGAGACTTTGAAGG - Intergenic
959365375 3:105451568-105451590 CAAAACAAAACAGACTTTGAGGG + Intronic
960190004 3:114692549-114692571 CATGACTAAACAGGCCTAGATGG + Intronic
960849842 3:122041523-122041545 CAGCACAAAACAGACTAAGATGG + Intergenic
963194905 3:142516212-142516234 AAGGACCATACAGACTAAGATGG - Intronic
964478912 3:157122743-157122765 CATGAGAAAACAGGCTCAGAAGG + Intergenic
964490834 3:157234272-157234294 CCTGAGCAAACACAATTAGAAGG + Intergenic
964900137 3:161648788-161648810 TATGACTAAACAGCTTTAGAAGG - Intergenic
966393579 3:179477938-179477960 CAACACAAAACAGACTAAGAAGG - Intergenic
966826140 3:183966629-183966651 GATGACCAACCAGATTTGGAGGG - Intronic
971175777 4:24281213-24281235 CAACACAAAACAGACTAAGACGG - Intergenic
972745536 4:41928734-41928756 TAAGCCCAAACAGACTTATAGGG - Intergenic
972954995 4:44377758-44377780 CATGATCAAACAGGCCTAGATGG + Intronic
973175222 4:47197281-47197303 CATGAACAAATAGACTTAAATGG - Intronic
973295478 4:48515355-48515377 CTTAATAAAACAGACTTAGATGG - Intronic
973615155 4:52670728-52670750 CAGGACCAAAGAGAATTATAGGG - Intergenic
979684889 4:123501126-123501148 CATGACCACACAGAACTCGAAGG - Intergenic
980431688 4:132707941-132707963 TATGAGCAAATAGACGTAGAAGG + Intergenic
980474725 4:133298006-133298028 CATGTACAAAGAGACTTAGAAGG - Intergenic
982520708 4:156413390-156413412 CTTGACCACACAGACTTTCAAGG + Intergenic
985379523 4:189377664-189377686 CATGAACAGACAGACAAAGAGGG - Intergenic
987994386 5:25256325-25256347 CATTACCAAACCTACTCAGAAGG + Intergenic
988477364 5:31598682-31598704 AATGACCAAAAAGACCTAGTGGG + Intergenic
992968499 5:82029645-82029667 CATGACGAACCAGACTAAGCTGG + Intronic
993518875 5:88873585-88873607 CAAGATCAAACAGTCTTGGAAGG + Intronic
994228356 5:97281823-97281845 CATGAGCACACAGACATAGAGGG - Intergenic
998774037 5:145578862-145578884 AATGAGTAAACAGAGTTAGAAGG + Intronic
1001500712 5:172231206-172231228 CATGACAAAACAAAATTATAAGG + Intronic
1001677824 5:173533108-173533130 GATGACAAAACAGGCTCAGAAGG - Intergenic
1002398177 5:178974037-178974059 CATGACTAAACAGATTTATTAGG + Intergenic
1006244968 6:32724962-32724984 CATAACCAAAGAGACTCACATGG + Intergenic
1006548512 6:34800545-34800567 CATCACCACACAGAGTTAAAAGG - Intronic
1008279747 6:49582565-49582587 CACTACCAAAAAGAATTAGAGGG - Intergenic
1009701254 6:67184759-67184781 AATGATTAAACAGACTTTGATGG + Intergenic
1010920145 6:81671025-81671047 TCTGACTAAACAGACTGAGAAGG - Intronic
1011441609 6:87392912-87392934 CATTACCAAAAATACTAAGAAGG + Intronic
1012102249 6:95104787-95104809 CTTGACCAAACAGTCATTGAAGG + Intergenic
1014582025 6:123150033-123150055 TATGACAAAACATACTTATATGG + Intergenic
1019920615 7:4161094-4161116 CAGGACCACACAGATTTGGAGGG + Intronic
1022132624 7:27418236-27418258 AATGACCAAACATAGTCAGAGGG + Intergenic
1022375755 7:29809484-29809506 CATGACAAAACAAACTTCGAGGG + Intronic
1027469881 7:78560207-78560229 AATCAGCAAACAGATTTAGATGG + Intronic
1033059865 7:138095878-138095900 CAGCACAAAACAGACTGAGAAGG - Intronic
1033422172 7:141213344-141213366 CATGAGCAAACAGAGTTTGTTGG + Intronic
1035984129 8:4406924-4406946 CAAGACCAAGCTGACTTAAAAGG + Intronic
1036775499 8:11609081-11609103 GAAGAGGAAACAGACTTAGATGG + Intergenic
1039275046 8:35926117-35926139 AATGACCAAACTGACTTACTAGG - Intergenic
1039364099 8:36912466-36912488 CATGAACAGCCAGACTTAGGAGG + Intronic
1039929367 8:41970428-41970450 GATGACCAAAGAGAGTTAAACGG - Intronic
1043160936 8:76846250-76846272 CATGACAAAACAGACTCTGGAGG - Intronic
1048525275 8:135196742-135196764 CAATACCAAACAGAAATAGATGG - Intergenic
1050470035 9:5978695-5978717 CAAGCCCAACCACACTTAGAAGG + Intronic
1050932906 9:11352219-11352241 GATGACCAAAGAGACTAAAAAGG + Intergenic
1055825992 9:80325532-80325554 TATGAACAAATAGAATTAGATGG + Intergenic
1057016549 9:91657531-91657553 CAGGACCAAACAGCCTGAGTTGG - Intronic
1059315030 9:113416916-113416938 AATGACCAAAAGGAATTAGATGG - Intronic
1060404120 9:123364671-123364693 CTTGACCAAACCCACTTAGGGGG + Intronic
1060575151 9:124685112-124685134 GATGAAGAAACAGATTTAGAAGG - Intronic
1185666529 X:1769636-1769658 CAAGACCAACCTGACTTACATGG + Intergenic
1186920306 X:14271229-14271251 CAACACAAAACAGACTAAGATGG + Intergenic
1187574215 X:20537373-20537395 GACAACCCAACAGACTTAGAGGG + Intergenic
1187711207 X:22056389-22056411 CATGACCAAACAGACTTAGAAGG - Intronic
1188812242 X:34664945-34664967 CATGTCCAAACAAACATAGGTGG + Intergenic
1189534276 X:41921593-41921615 CATGACCAGCCAGACTTAAAAGG - Intronic
1191845535 X:65544887-65544909 GTTGAGGAAACAGACTTAGAAGG - Intergenic
1195309639 X:103618940-103618962 CTAGACCAAACAGACATATATGG + Intronic
1196164428 X:112522911-112522933 CAACACAAAACAGACTAAGAAGG - Intergenic
1196267221 X:113664519-113664541 CATGAGCAAACAGACAAGGAAGG + Intergenic
1196872550 X:120126550-120126572 GATGACTAAATAGACTTAGCAGG - Intergenic
1197422550 X:126256837-126256859 AATGATCAAAAAGACATAGAAGG - Intergenic
1197839065 X:130726121-130726143 CATGAACAAACAGTTTCAGATGG + Intronic
1202092203 Y:21204446-21204468 CATTACCACAAAGATTTAGAAGG + Intergenic
1202582107 Y:26392799-26392821 CAACAACAAACAGAATTAGAAGG + Intergenic