ID: 1187715424

View in Genome Browser
Species Human (GRCh38)
Location X:22097709-22097731
Sequence ATGGTGTTTTAGGTAGGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187715418_1187715424 -4 Left 1187715418 X:22097690-22097712 CCAATCTAAAAAACACCATATGG 0: 1
1: 0
2: 2
3: 18
4: 176
Right 1187715424 X:22097709-22097731 ATGGTGTTTTAGGTAGGATAGGG 0: 1
1: 0
2: 2
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187715424 Original CRISPR ATGGTGTTTTAGGTAGGATA GGG Intronic
901383960 1:8894529-8894551 ATGGTATTTCAGGCAGGACATGG - Intergenic
902135030 1:14297674-14297696 ATGGGGTTGTAGGTAGCATTGGG - Intergenic
903876299 1:26475898-26475920 ATGGTATTTCAGGCAGGACATGG - Exonic
905948710 1:41926828-41926850 ATGGAGTTTTAGGGAAAATATGG + Intronic
906165216 1:43681003-43681025 ATTGTATTTTAGCTATGATAGGG - Intronic
908111812 1:60905310-60905332 AGGGTGTTAAAGGTAGAATATGG + Intronic
915337025 1:155150206-155150228 ATGGTATTTCAGGCAGGACATGG - Intergenic
916185352 1:162126426-162126448 ATGATGCATTAGGAAGGATATGG - Intronic
916429669 1:164715286-164715308 ATGATGTCTTTGGTAGTATATGG + Intronic
919912757 1:202122091-202122113 ATGGTGTTTTAGGCCGGGTGCGG + Intergenic
921382731 1:214541660-214541682 ATGGGCTTTTGGGTAGGAAATGG - Intronic
922039515 1:221882846-221882868 ATGGTGGTCAAGGTAGGATAAGG + Intergenic
922941921 1:229474391-229474413 TTGTTATTTTAGGTGGGATATGG - Intronic
1063590358 10:7389322-7389344 AGGGTGTTGTAGTTAGGAAAAGG - Intronic
1064138255 10:12768838-12768860 ATCGTGTTTTATGTAGAATTGGG - Intronic
1064273441 10:13885556-13885578 ATGGTGCTTTAGGAATGAAAGGG - Intronic
1064526840 10:16266032-16266054 ATGGAATTTTAGGTATGATGGGG - Intergenic
1065337818 10:24672476-24672498 ACGGTGTTTAATGTAGGAAATGG - Intronic
1070936802 10:80304684-80304706 ATGGTGTTTTAGGTCTGAAAAGG + Intergenic
1071279033 10:84082737-84082759 ATGGTATTTCAGGCAGGACATGG - Intergenic
1072478588 10:95787423-95787445 TAGGTGTTTTAGGAAGGAGAGGG + Intronic
1073574994 10:104615170-104615192 ATGGTCTTTGAGATAGGACATGG - Intergenic
1073804629 10:107083972-107083994 AAGTTGTGTTAGGTAGGAAATGG - Intronic
1078228748 11:9419235-9419257 ATATTTTTTTAAGTAGGATAAGG - Intronic
1078693850 11:13609651-13609673 ATGGTATTTCAGGCAGGACATGG + Intergenic
1079563767 11:21854846-21854868 ATGGTGGTTTAGTTTGGAGAAGG + Intergenic
1079704292 11:23594312-23594334 ATGGTGTTTGAGGCAAGAGAAGG + Intergenic
1086161271 11:83724736-83724758 AGGCTGTTTTAGGAAGGAAAGGG + Intronic
1086592276 11:88529601-88529623 ATCCTGTTTTATGTAGCATAAGG - Intronic
1089741460 11:120587569-120587591 ATGGAGTTCTAGGTAGGAATGGG + Intronic
1089986382 11:122817946-122817968 ATGGTTTCTTAGGTAAGACAAGG + Intergenic
1092854844 12:12663723-12663745 ATGGTTATTAAGGTAAGATAAGG + Intronic
1094001150 12:25696086-25696108 ATGGTGTTTTAGTGAAGTTAGGG - Intergenic
1094383472 12:29868587-29868609 ATGCTGTGATAGGCAGGATATGG - Intergenic
1094669728 12:32557825-32557847 TAGGTGTTTTAGCTAGCATATGG + Intronic
1097491514 12:60277369-60277391 GAGTTGTTTTTGGTAGGATAAGG - Intergenic
1098937229 12:76494279-76494301 ATAGTGGTTTTGGTAGGAAAAGG + Intronic
1101169017 12:102068777-102068799 ATGGTGTTTTGGGGAGGAAGTGG + Intergenic
1104546366 12:129716562-129716584 GTGGTGTGGTAGGTAGAATAAGG + Intronic
1105800864 13:23902475-23902497 ATAGAGTTTTGGGTAGGAAAGGG - Intronic
1105803715 13:23936179-23936201 AGGGTGTTTGAGGAAGGATGGGG - Intergenic
1106290432 13:28356212-28356234 ATGGGGTTGTTGGGAGGATATGG + Intronic
1109771161 13:66975333-66975355 ATGGATTTTTTGTTAGGATAAGG + Intronic
1109885801 13:68542702-68542724 ATGGGGTTTGAGGTAGGGTATGG + Intergenic
1111597781 13:90433298-90433320 ATATTGTTTAAGGTAGGGTAGGG + Intergenic
1111998648 13:95190050-95190072 AAGTTGTTTTAGGCAGGGTACGG + Intronic
1112733933 13:102396828-102396850 ATGGCATTTTAGGTAGGCTTCGG - Intronic
1113044875 13:106145286-106145308 ATGGTGTTTCTGGTTAGATAAGG + Intergenic
1113075371 13:106462857-106462879 ATGGTTTTATAGGTAGCCTAAGG - Intergenic
1114756506 14:25266297-25266319 ATGGTATTTCAGGCAGGACATGG + Intergenic
1115822690 14:37228466-37228488 ACGGTTTTTTAGGTAAGGTAAGG - Intronic
1116498846 14:45595848-45595870 ATGAGGTGTTGGGTAGGATAGGG - Intergenic
1117855921 14:60033414-60033436 ATGATGTTTTCAGTAGGTTATGG + Intronic
1117941474 14:60971499-60971521 ATGGTATTTCAGGCAGGACATGG + Exonic
1119863174 14:77951697-77951719 ATGGTGTGTTAGGTCTGATTGGG + Intergenic
1119955240 14:78791140-78791162 ATGTTGTTTTAGGTGTGATAAGG - Intronic
1120132464 14:80823534-80823556 ATGGTATTTCAGGCAGGACATGG - Intronic
1120346352 14:83295443-83295465 GTGGTGTGTTAAGTAGAATATGG - Intergenic
1120917895 14:89726155-89726177 ATGATGTTTTACGTTGAATATGG + Intergenic
1124445903 15:29731732-29731754 ATGGTATTTCAGGCAGGACATGG - Intronic
1125047405 15:35258217-35258239 ATGGTGTGAGAGGTAGGATTGGG + Intronic
1126095310 15:45084532-45084554 ATGGAGTTTGAGGTAAGGTAGGG - Intergenic
1126154884 15:45556657-45556679 ATGGTATTTTGGGCAGGACATGG - Intergenic
1128365642 15:67000052-67000074 ATGGTATTTCAGGCAGGACATGG + Intergenic
1128463913 15:67892357-67892379 ATGCTGTTATAGGTAGTGTAGGG + Intergenic
1128469681 15:67941727-67941749 ATGGTGTTTTATGTATGCTGTGG + Intergenic
1129632794 15:77279770-77279792 ATGGTATTTCAGGCAGGACATGG - Intronic
1132084822 15:98899567-98899589 AAGGTTTTTTAGGAAGGACAAGG - Exonic
1135858249 16:26031769-26031791 ATGGTATTTCAGGCAGGACATGG + Intronic
1137790600 16:51171603-51171625 ATGGTGTTCTAGAGAGAATATGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1140176109 16:72661675-72661697 TTTGTTTTTGAGGTAGGATATGG - Intergenic
1141217282 16:82036426-82036448 ATGGAGTTTAAGCTTGGATAGGG + Intronic
1143964518 17:10747451-10747473 ATGGTGTATCAGGTAGGATATGG + Intergenic
1144129694 17:12234292-12234314 AGGCTGTTTTAGGTGAGATAGGG + Intergenic
1145908350 17:28528561-28528583 ATGGTGTTTTATGGGGGATGGGG - Intronic
1146266567 17:31457164-31457186 ATCGTGTTTTAGGTAGAGAATGG + Intronic
1147482810 17:40783028-40783050 ATGGTAATTCAGGAAGGATAAGG - Intergenic
1149183866 17:53974270-53974292 ATGGTGTGTTATGTAGCATGGGG + Intergenic
1149896783 17:60434408-60434430 ATGGTATTTCAGGCAGGACATGG + Intergenic
1149898554 17:60451227-60451249 ATGATGTTAAAGGTAGGAGAAGG + Intronic
1150014145 17:61536470-61536492 AGCATGTTTAAGGTAGGATAAGG - Intergenic
1150171773 17:63003952-63003974 ATGGTATTTCAGGCAGGACATGG + Intergenic
1150957777 17:69880298-69880320 AAAGAGTTTTAGGTAGGAAATGG + Intergenic
1157368415 18:47087899-47087921 ATGGAGTTTTATGTGGGATTAGG - Intronic
1162865652 19:13544610-13544632 ATGGTGTATTAGATAGGATAAGG - Intronic
1165233206 19:34400366-34400388 ATGGTGCTTTATGTAGCAGAGGG + Exonic
1165633583 19:37321950-37321972 ATTGTGTTTTTGGTAGTATATGG + Intronic
925685810 2:6471974-6471996 TTTATGTTTTAGGTAGGATAGGG + Intergenic
927144842 2:20156603-20156625 ATGGTGTATTAATTAAGATAAGG + Intergenic
927588531 2:24332284-24332306 ATGGTATTTCAGGCAGGACATGG - Intronic
928016071 2:27658384-27658406 ATGGTGTATTATGCAGGATACGG - Intronic
928636992 2:33257029-33257051 ATTCTGATTTGGGTAGGATAAGG + Intronic
929019664 2:37539101-37539123 ATGCATTTTTAGGTAGCATAAGG + Intergenic
930442158 2:51422528-51422550 ATGGTGTTTAAAGTAGCATTTGG + Intergenic
932318725 2:70804171-70804193 ATGGTATTTCAGGCAGGACATGG - Intergenic
934992381 2:98930561-98930583 TAGGTGATATAGGTAGGATAGGG - Intronic
935168409 2:100589976-100589998 ATGGTATTTCAGGCAGGACATGG + Intergenic
936492040 2:112980402-112980424 ATGGTATTTCAGGCAGGATATGG + Intronic
936620072 2:114086581-114086603 ATGATATTTTAGGTCGTATATGG + Intergenic
936920652 2:117685296-117685318 AGGGTGTTTGAGGTAGAAGATGG - Intergenic
937008614 2:118541435-118541457 AAAGTGTTTTAGGTAAGATTTGG + Intergenic
942931202 2:181495262-181495284 ATAGTGTTTTAGGTAGTCAAAGG + Intronic
943338923 2:186653336-186653358 ATGGTGATTTTGGTAGTATATGG - Intronic
944032410 2:195251405-195251427 ATGGTGTGTTAAGTAGTAAATGG - Intergenic
944887845 2:204083129-204083151 ATGGTATTTTGAGTAGGATCTGG - Intergenic
1173174633 20:40754989-40755011 ATGGTGTCTTAGGGAGCAAAGGG - Intergenic
1174148926 20:48472455-48472477 CTGGTGTTTTAGGTAGAAGCTGG - Intergenic
1177853760 21:26378693-26378715 ACGGGGGTTTAGGTAGGATGTGG + Intergenic
1177957736 21:27621329-27621351 ATGATGTTGTATGTAGAATACGG - Intergenic
1178489890 21:33042792-33042814 TTGGTGTGTTAGGAAGGAAAAGG + Intergenic
1184005870 22:41708469-41708491 ATGGTATTTCAGGCAGGACATGG + Intronic
1184023731 22:41838361-41838383 AAGGTGTTTTATGGAAGATAGGG + Intronic
1185172014 22:49299658-49299680 ATGGTGTTTGCGGCAGGATGTGG - Intergenic
951416395 3:22428239-22428261 ATGGTTTTCTAGGTAAGATCAGG + Intergenic
953192168 3:40698301-40698323 ATGGTATTTCAGGCAGGACATGG + Intergenic
956827611 3:73013142-73013164 ATGTTGCTTTTGGTAGGATATGG + Intronic
959830438 3:110855365-110855387 AATGTGTTTTAGATAAGATAAGG + Intergenic
963131639 3:141863919-141863941 ATGGTATTTCAGGCAGGACATGG + Intergenic
963462362 3:145633061-145633083 GTGGTGTTTTAGGGAGTAGAAGG + Intergenic
964548199 3:157858407-157858429 ATGGTGTCTTAGATAGGGCAAGG - Intergenic
965378663 3:167959787-167959809 ATGGTATTTCAGGTAGAACATGG - Intergenic
967677603 3:192317964-192317986 TTGGTGTTTTGGGTAAGATTGGG - Intronic
967933925 3:194711255-194711277 ATGGTGTTATAGGCAGTGTACGG - Intergenic
974801787 4:66827988-66828010 GTGGTATTTTAGGGAGGATCAGG + Intergenic
976311807 4:83620594-83620616 ATGGTGATTAAGGTAGAATGAGG - Intergenic
976345728 4:83997809-83997831 AAGGTATTTAAGGTAGGATGAGG + Intergenic
976509906 4:85896378-85896400 ATTGTTTTTTTGGTAGGATATGG - Intronic
977983174 4:103350064-103350086 ATCTTATTTTAGTTAGGATATGG + Intergenic
982245789 4:153348920-153348942 ATGATGTTTTTGGTTGGATGGGG + Intronic
982850790 4:160313085-160313107 ATGATGTTTTAGATACGATAGGG - Intergenic
983428685 4:167620079-167620101 AGGCTGTAGTAGGTAGGATAAGG + Intergenic
983497127 4:168455533-168455555 ATGTGATTTTAGGTAGGTTAGGG + Intronic
985651747 5:1110938-1110960 ATGGTGGGTTAGGAAGGATCTGG + Intronic
992101415 5:73411169-73411191 ATGGCATTTCAGGCAGGATATGG - Intergenic
992381408 5:76241251-76241273 ATGGTATTTCAGGCAGGACATGG + Intronic
993553223 5:89301956-89301978 AAGGTGTATTAGTTAGGAAAAGG - Intergenic
993852810 5:93032288-93032310 ATGTTGTTTGAGGTAGCATTTGG + Intergenic
995155806 5:108911844-108911866 ATGCAGTTTTAGTTATGATATGG + Intronic
996186510 5:120483001-120483023 ATGGTAGGTTAGGTAGGTTAGGG + Intronic
996377034 5:122821965-122821987 ATGTAGGTTTAGGTAGGTTAGGG - Intronic
997834178 5:137178981-137179003 ATGGTGTGTTGGGTAGGGAATGG + Intronic
1000921256 5:167140646-167140668 AATACGTTTTAGGTAGGATAGGG + Intergenic
1001160441 5:169307940-169307962 ATTGTGTTTGAGGTGGGAAAGGG + Intergenic
1001840656 5:174873548-174873570 ATGGTCACTTAGGAAGGATAAGG + Intergenic
1004264380 6:14136263-14136285 ATGGTGTTTTGGGGATGAGAGGG + Exonic
1006560354 6:34906063-34906085 ATGGTGGTTGAGGTGGGATTAGG - Intronic
1008103941 6:47422684-47422706 ATGAGTTTATAGGTAGGATAGGG - Intergenic
1010157795 6:72814895-72814917 TTGGAGTTTTAAGTAGGAAACGG + Intronic
1010437544 6:75851510-75851532 ATGTTGGTTTTGGCAGGATATGG + Intronic
1010468612 6:76198713-76198735 AGGGTGTGTGAGGTATGATAGGG + Intergenic
1013077484 6:106784215-106784237 AGAGTGGTTTAGGTGGGATATGG - Intergenic
1013094350 6:106931019-106931041 ATGGTATTTCAGGCAGGACAGGG + Intergenic
1013115593 6:107101566-107101588 ATGTTTTTTCAGGTAGGAGATGG - Intronic
1013120315 6:107135020-107135042 ATGTTTTTTCAGGTAGGAGATGG + Intergenic
1013857375 6:114590577-114590599 ATGGTGTTTGAGGGAGTAAAAGG + Intergenic
1013954754 6:115828122-115828144 AAGGTCTTCTAGGTAGGAAAAGG - Intergenic
1014007575 6:116437555-116437577 ATGGTGTTTTTGGAAGTATTTGG + Exonic
1014434868 6:121409851-121409873 ATGGTATTTCAGGCAGGACATGG - Intergenic
1017458739 6:154628238-154628260 ATGTTGTTTTACGTAGTACAAGG - Intergenic
1018513899 6:164556963-164556985 ATGGTGTATTAAGTAAGATCAGG - Intergenic
1022025905 7:26447717-26447739 ATGGTGATTTCAGTAGGACATGG + Intergenic
1022883714 7:34619931-34619953 ATGGTGTTTTAGTCAGGTTAGGG - Intergenic
1023066688 7:36384944-36384966 ATGGCCTTGTAGGTATGATAAGG + Intronic
1023264304 7:38390361-38390383 ATTGTATATAAGGTAGGATAGGG - Intronic
1025731396 7:64111626-64111648 ATGGTGTGATAGGTAGCATGGGG + Intronic
1027504093 7:78993725-78993747 AAGGTGTTTTAAGAAGGACAAGG - Intronic
1030554979 7:111012666-111012688 CTGGAGTTTTAGGTAAGTTAGGG + Intronic
1032141414 7:129334395-129334417 CTGGTGTATTAGATAGGATCAGG - Intronic
1033656458 7:143378369-143378391 AAGATGTTTTAGGTAGTAAAGGG + Intergenic
1033764102 7:144468881-144468903 CTGATGTTTTAGGAAGAATAAGG - Intronic
1034541476 7:151761218-151761240 ATGGTGTTTTAGTTTGGGGAAGG - Intronic
1036632118 8:10523301-10523323 ATGATGATATAGGTCGGATATGG - Intergenic
1038876166 8:31552205-31552227 ATGGGCTTTGAGGTAGGATCTGG + Intergenic
1039776452 8:40742288-40742310 ATGGTTTTTTAGGCAGAATTGGG - Intronic
1042035838 8:64533068-64533090 TTTGGGTTTTAGATAGGATAGGG - Intergenic
1042230125 8:66546083-66546105 TTGGTTTTATAGGTAGGATTTGG - Intergenic
1042295333 8:67211432-67211454 TTTGTGTTTTATGTAGGAAAGGG - Intronic
1043331316 8:79121480-79121502 ATGGTTTTTGAGGAAGAATACGG + Intergenic
1043848509 8:85189183-85189205 ATTGTATTTTAGGTTGGAAAAGG - Intronic
1044245384 8:89938168-89938190 CTGGTCTTTTAGAGAGGATAGGG - Intronic
1045497582 8:102721239-102721261 AGGGTCTTTTTGGTAGGAGATGG + Intergenic
1045682211 8:104674464-104674486 ATTTTGTTTTATGTAGGACATGG + Intronic
1046635470 8:116670478-116670500 TTTGTGTTTTTGGTAGGAGAAGG - Intronic
1046844419 8:118900031-118900053 ATGGATTTTTAGGTATTATATGG + Intergenic
1048096387 8:131300097-131300119 ATGGTGGTATAGGCAGTATAGGG + Intergenic
1050406368 9:5312650-5312672 ATGGTATTTCAGGCAGGACATGG - Intergenic
1052246178 9:26337846-26337868 ATTCTGTTTTAGGTAAGATAGGG - Intergenic
1061416811 9:130451534-130451556 ATGGGGTTGCAGGTAGGAGAGGG + Intronic
1061573766 9:131493625-131493647 ATGGTGTTTTAGGGGGGTTGGGG + Intronic
1187715424 X:22097709-22097731 ATGGTGTTTTAGGTAGGATAGGG + Intronic
1188172969 X:26950803-26950825 ATGTTGTTTTAGGTATCATTTGG + Intergenic
1189156679 X:38764990-38765012 GTGGTGTTTTAGGCAGGGCATGG + Intergenic
1190002835 X:46706116-46706138 ATGGTTTTTAAGGATGGATAAGG + Intronic
1192240533 X:69324336-69324358 ATGCTCTTGTGGGTAGGATATGG + Intergenic
1195017503 X:100793799-100793821 ATAGTGTTTAAGGTTGGATAGGG - Intergenic
1196539873 X:116895161-116895183 AGAGTTTGTTAGGTAGGATAGGG - Intergenic
1196720494 X:118849187-118849209 ATAGTATTTAAGGTATGATATGG + Intergenic
1197129128 X:122983868-122983890 ATGGTGTAATAGGTATGATCTGG - Intergenic
1198654243 X:138896583-138896605 ATGCTGTCTTATGAAGGATAGGG - Intronic
1199999548 X:153051392-153051414 ATGGTATTTCAGGCAGGACATGG + Intergenic