ID: 1187717215

View in Genome Browser
Species Human (GRCh38)
Location X:22114622-22114644
Sequence CAATTTAGCCAGATCTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187717211_1187717215 0 Left 1187717211 X:22114599-22114621 CCCCAGCTAGCAAAAAATAATGG 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1187717215 X:22114622-22114644 CAATTTAGCCAGATCTGACAAGG 0: 1
1: 0
2: 1
3: 8
4: 95
1187717214_1187717215 -2 Left 1187717214 X:22114601-22114623 CCAGCTAGCAAAAAATAATGGCA 0: 1
1: 0
2: 3
3: 20
4: 155
Right 1187717215 X:22114622-22114644 CAATTTAGCCAGATCTGACAAGG 0: 1
1: 0
2: 1
3: 8
4: 95
1187717213_1187717215 -1 Left 1187717213 X:22114600-22114622 CCCAGCTAGCAAAAAATAATGGC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1187717215 X:22114622-22114644 CAATTTAGCCAGATCTGACAAGG 0: 1
1: 0
2: 1
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187717215 Original CRISPR CAATTTAGCCAGATCTGACA AGG Intronic
904950032 1:34229917-34229939 CAATTTGGGCATATCTGATATGG + Intergenic
907591925 1:55682501-55682523 TATTTCAGCCTGATCTGACAAGG - Intergenic
909395253 1:75164598-75164620 CAATTTAGGCAGGACAGACAAGG - Intergenic
909908156 1:81224406-81224428 CAACTTAGCCTGAGCTGATAAGG + Intergenic
912147529 1:106811190-106811212 CAATATAGCCAAATATGTCAAGG + Intergenic
921913926 1:220584983-220585005 CAATTTGGCCAGTTCTTACGTGG + Intronic
922248308 1:223822062-223822084 AAAATTAGCCAGATGTGGCATGG - Intronic
922634810 1:227157535-227157557 CACTTTAACCACATCTGACATGG + Intronic
1064107994 10:12516545-12516567 CAGTTTAGCAATTTCTGACAAGG - Intronic
1065677941 10:28197939-28197961 CAATGTAACCAGATGTTACAGGG + Intronic
1066406554 10:35124743-35124765 TAATTGAGCAAGATCTGATATGG + Intergenic
1066427214 10:35318465-35318487 CAGTTTTGCTGGATCTGACATGG + Intronic
1066626797 10:37415359-37415381 AAATTTAGCCAGGCATGACAGGG + Intergenic
1069307701 10:66992079-66992101 CAATTTGGCAACATCTGATAAGG - Intronic
1075855342 10:125625036-125625058 CAATCTCTCCAGATCTGGCAAGG + Intronic
1080524755 11:33103972-33103994 TTAATTAGCCAGATCTGGCAGGG - Intronic
1081402192 11:42656236-42656258 CAATTCACCCAGATTTGAAATGG - Intergenic
1082724921 11:56722961-56722983 AAAATTAGCCAGATGTGATAGGG - Intergenic
1086315781 11:85590232-85590254 TAATTCAGCCAAATCTGGCATGG - Intronic
1088901800 11:114123839-114123861 CCATTTAGCCACAGGTGACAGGG - Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1093243911 12:16712030-16712052 AAATTTAGCCATATCTTAGAGGG + Intergenic
1096328011 12:50683271-50683293 GAATGTAGCCTGATGTGACATGG + Intronic
1102086571 12:110145778-110145800 AATTTTAGCCAGATCTGACTTGG - Intronic
1107368889 13:39719713-39719735 CAATTTAGGCACAGCTGACATGG + Exonic
1110982262 13:81915923-81915945 CAATTTCCCAAGTTCTGACAAGG - Intergenic
1112682608 13:101784399-101784421 CAATTTATTCAGATCCCACAAGG + Intronic
1115087615 14:29536012-29536034 GAATTCAGCCAGATTTGACAGGG - Intergenic
1115913171 14:38279378-38279400 TAATTTAACCAGAACTTACATGG - Intergenic
1116799277 14:49426429-49426451 CCATTTCTCCAGATCTCACAGGG + Intergenic
1120444794 14:84580564-84580586 CAATTTAGCCACAAATGATAAGG + Intergenic
1124230823 15:27944823-27944845 CCATTTAGCCAGGTCCTACATGG + Intronic
1146389039 17:32404150-32404172 AAATTTGGCCATATGTGACATGG + Intergenic
1148079076 17:44957595-44957617 CATTCTAGCCAGACCTGCCAGGG + Intergenic
1151073123 17:71240272-71240294 TAATTTTGCCAGAACTGACTAGG - Intergenic
1153722674 18:7922735-7922757 CATTTTTGCCAGTTCTGAAATGG - Intronic
1156928673 18:42614841-42614863 CACTTTAGCCAGAGCTGGAAAGG + Intergenic
1158366905 18:56746617-56746639 TAATACAGCCAGATCAGACAGGG + Intronic
1159129326 18:64261954-64261976 TAATTTAACCAGATCTGACAAGG + Intergenic
1166054747 19:40281611-40281633 CAATCAAGTCAGAACTGACAAGG - Intronic
1166327261 19:42058919-42058941 CGATGTAGCCAGATCTGACTCGG + Intronic
1168458609 19:56535387-56535409 CATCTTAGCCAGATATCACAAGG + Intergenic
927148218 2:20180591-20180613 CAGTGAAGCCAGATCTGAAATGG - Intergenic
927762508 2:25772131-25772153 GAGTTTAGCCAGATCTGAGTGGG + Intronic
936522327 2:113219140-113219162 CAATTTAGCCAGAAAAGACGAGG - Intronic
937131620 2:119518255-119518277 CAATTTAGACACATCTGTAAGGG + Intronic
941524623 2:166591897-166591919 CATATTAGACATATCTGACAAGG - Intergenic
945265895 2:207891020-207891042 CAATTTTTCCATCTCTGACATGG - Intronic
947137543 2:226990160-226990182 CAATTTAGCAAGACATGAAAAGG - Intronic
947282446 2:228470326-228470348 CTATTAAGCCACAGCTGACACGG + Intergenic
950381736 3:12621313-12621335 CATTTTAGTCAGAGCTGAAATGG + Intronic
953015271 3:39069129-39069151 AAAATTAGCCAGATGGGACAAGG - Intronic
956723677 3:72139420-72139442 TAATTGAGGCAGATCTTACATGG - Intergenic
959892690 3:111574160-111574182 CAGTGCAGCCAGCTCTGACATGG + Intronic
960761318 3:121076321-121076343 CAATTTATCCATCCCTGACAAGG - Intronic
962874334 3:139524390-139524412 GGATTCAGCCAGATCTGAAAGGG + Intronic
963715714 3:148801403-148801425 AAATTTAGCCAGATCTTTCAAGG - Intronic
965492070 3:169349704-169349726 CAATTAAGCCCCACCTGACAGGG - Intronic
965916436 3:173852825-173852847 CAATCTAGCTAGATCTGCTAAGG + Intronic
979585002 4:122404906-122404928 GAATTTAGCAAGATGTGAGAAGG - Intronic
979740917 4:124149756-124149778 CAATTGAACCAGATTTGGCAAGG + Intergenic
980428941 4:132665113-132665135 CAATTGAACCAAAGCTGACATGG + Intergenic
982306471 4:153936860-153936882 CAATGTAACCAGATCTGTGATGG + Intergenic
984349797 4:178576175-178576197 CAATTTAACCAGAACAGTCACGG + Intergenic
987770972 5:22304819-22304841 CAATTTATGCATAACTGACAAGG - Intronic
992804995 5:80328649-80328671 CAATTTAGCCATTCCTTACAAGG - Intergenic
998896185 5:146802644-146802666 TTATTTAGCCAGATAAGACATGG + Intronic
999630398 5:153564837-153564859 CAAAATACACAGATCTGACAAGG - Intronic
1011575729 6:88796439-88796461 AATTTGAGCCAAATCTGACATGG + Intronic
1014625165 6:123715979-123716001 CCATCTAGCCAGACATGACATGG + Intergenic
1015187706 6:130437095-130437117 CAATTTATACACATCTGCCATGG - Exonic
1020808200 7:12817284-12817306 CAAAATAGGCAGATCTGACAAGG - Intergenic
1022115994 7:27261109-27261131 CATTTTAGAAAGATGTGACAAGG + Intergenic
1030571597 7:111232495-111232517 GAGGTTAGCTAGATCTGACATGG + Intronic
1036564355 8:9925538-9925560 CTATGTAGCCAGCTCTCACATGG - Intergenic
1037790015 8:21930503-21930525 TAATTAAGCCAGATCTGAAAAGG + Intronic
1038182770 8:25244552-25244574 GAAATTAGGCAGATTTGACAGGG + Intronic
1040096444 8:43448506-43448528 CAAACTAGTCAAATCTGACAGGG - Intergenic
1041483778 8:58351662-58351684 AAATTTACCCAGATATGACCGGG + Intergenic
1046918304 8:119700354-119700376 GAATTTCTCCAGATCTGACCAGG + Intergenic
1048242945 8:132762224-132762246 AAATTTAGGCAGATGTGACCAGG - Intergenic
1050014073 9:1214859-1214881 AAATGTAGCCACATCTGACTGGG + Intergenic
1052216620 9:25973504-25973526 CATTTTAGCAAGATCTTAAAGGG + Intergenic
1052324776 9:27205904-27205926 GAATTGAGCCAGCTCTGGCATGG - Intronic
1052418250 9:28205650-28205672 GTATTTATCCAGATCTGACCAGG + Intronic
1052452811 9:28653584-28653606 CAATAAAGCCATATCTGAGAGGG - Intronic
1052959754 9:34285477-34285499 AAAATTAGCCAGGTCTGGCAGGG + Intronic
1053810803 9:41849943-41849965 CATTTTAGCTAGATCTGGTAGGG + Intergenic
1054619790 9:67337496-67337518 CATTTTAGCTAGATCTGGTAGGG - Intergenic
1058246903 9:102638043-102638065 CATTTTAGTCAGATCTTACCTGG + Intergenic
1058514641 9:105757901-105757923 CAGTTTGGCAATATCTGACAAGG + Intronic
1185805433 X:3053016-3053038 CAAATTAGCAAGTTCTGGCATGG + Intronic
1186625896 X:11292990-11293012 CAATTTCTCCTGATCTGAAAGGG + Intronic
1187717215 X:22114622-22114644 CAATTTAGCCAGATCTGACAAGG + Intronic
1189516342 X:41716741-41716763 CAATTTTGCCAGATGGGATAAGG - Intronic
1190595129 X:52044855-52044877 TAATTTAGCCACATCCTACAAGG - Intergenic
1190613695 X:52209218-52209240 TAATTTAGCCACATCCTACAAGG + Intergenic
1191881402 X:65846802-65846824 AAAATTAGCCAGACCTTACATGG - Intergenic
1193555154 X:82944969-82944991 AAATTTTCCCAGATCTGAGATGG - Intergenic
1194590358 X:95792804-95792826 CAATATAGCCAGAAATGAAATGG - Intergenic
1194955319 X:100172501-100172523 CAATACGGTCAGATCTGACAGGG + Intergenic
1197248280 X:124188591-124188613 AAATTTTGCCACCTCTGACAAGG - Intronic
1198986770 X:142463717-142463739 CAATTAAGCTAGATCTGAGTTGG - Intergenic
1199496664 X:148459768-148459790 CAATTTGGGCAATTCTGACAAGG + Intergenic
1199663130 X:150072654-150072676 CAATTTTGCCTGATCTCTCAGGG + Intergenic