ID: 1187722489

View in Genome Browser
Species Human (GRCh38)
Location X:22165692-22165714
Sequence AGGGCTCTGACCAGATTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187722489_1187722492 28 Left 1187722489 X:22165692-22165714 CCAGGGAATCTGGTCAGAGCCCT 0: 1
1: 0
2: 2
3: 21
4: 195
Right 1187722492 X:22165743-22165765 CTTTTATGAAACCCAGAATCTGG 0: 1
1: 0
2: 0
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187722489 Original CRISPR AGGGCTCTGACCAGATTCCC TGG (reversed) Intronic
900607533 1:3530572-3530594 AGGGCTGTAACCTGCTTCCCAGG + Intronic
902842367 1:19083120-19083142 AGGGCTCTGTCCAGGGCCCCAGG + Intronic
904829263 1:33296225-33296247 AGGGCTCTGAGCAGCATTCCAGG + Intronic
906970730 1:50510578-50510600 AGGGCTCTGATAAGTGTCCCAGG + Intronic
907299644 1:53478572-53478594 AAATCTCTGTCCAGATTCCCTGG + Intergenic
907388663 1:54142071-54142093 AGGGCCCTGACCACATTCCCTGG - Intronic
908139920 1:61173727-61173749 AGGGCTCTGAAGATATTCCTGGG + Intronic
908884049 1:68767206-68767228 GGGGCTCTGACTAGCTTCACTGG + Intergenic
909896322 1:81074685-81074707 GGGGTTTTAACCAGATTCCCAGG + Intergenic
911529995 1:99032767-99032789 ATGGCTCTTACCAGATCCCTGGG - Intergenic
913419194 1:118645702-118645724 AGGGCTGAGACCAGTTTACCTGG + Intergenic
915080185 1:153346595-153346617 ACGGCTCAGACCAGTTCCCCCGG + Intronic
915331117 1:155112900-155112922 AGGGCCCTGACAGGCTTCCCTGG - Intergenic
917526812 1:175795498-175795520 AGGGCTCTAACCAGTTCCCCAGG - Intergenic
919944508 1:202309529-202309551 TGGGCTCTGCCCTGATTCCAGGG - Intronic
920314430 1:205067239-205067261 AGGACTCTCACCTGCTTCCCTGG - Exonic
923419750 1:233800831-233800853 AGGGCTCTGTCTTGATTTCCTGG + Intergenic
1063065087 10:2599998-2600020 ATGTCTCTGCCCACATTCCCTGG + Intergenic
1064142656 10:12803732-12803754 AGAGCTCTGGACAGATGCCCAGG + Intronic
1067051631 10:43024885-43024907 AGGGCTCTGGGCAGGCTCCCGGG - Intergenic
1067221309 10:44346219-44346241 AGTGCTATGACCAGGTGCCCAGG + Intergenic
1067682250 10:48448550-48448572 GGGGCTCTGACCAGAGTCCTGGG + Intronic
1068828824 10:61469618-61469640 AGTGCTCTGACCACAGACCCAGG - Intergenic
1069723524 10:70563863-70563885 AGGGCTCTGACCAGTGGCCTGGG - Intronic
1069811267 10:71161629-71161651 AGGGCACTGGCCAGACTCCTGGG + Intergenic
1070762672 10:79034446-79034468 AGGGCTCGGGCCAGAGACCCGGG - Intergenic
1071391889 10:85183644-85183666 ATGACTCTGAGCACATTCCCTGG - Intergenic
1073720776 10:106168861-106168883 AGGTCTCTGACCACATTCATTGG + Intergenic
1074422597 10:113322600-113322622 AGGGCTCAGACCAGCAGCCCAGG - Intergenic
1074967130 10:118501232-118501254 AGGGCTGTGACCACACTTCCAGG - Intergenic
1075339380 10:121633243-121633265 AGGGCTCTCAGCTGACTCCCAGG + Intergenic
1076214587 10:128682812-128682834 GAGCCTCTGACCAGAGTCCCCGG + Intergenic
1077107048 11:846707-846729 TGGGCTCTGAGCAGACACCCAGG - Intronic
1077197908 11:1290549-1290571 ACGGCTGTGACCTGCTTCCCAGG + Intronic
1079903497 11:26217983-26218005 ATGGCTGTGACCACATTCTCTGG - Intergenic
1081589054 11:44408263-44408285 AGGGACCTGCCCACATTCCCAGG + Intergenic
1084558452 11:69889285-69889307 GGGGCACTGCCCAGATCCCCTGG - Intergenic
1084965314 11:72741458-72741480 AGGGCTCTGGCCTGGCTCCCTGG + Intronic
1085042365 11:73334209-73334231 AGGGCACTGACCAAACTGCCTGG - Intronic
1085296808 11:75436030-75436052 AGGGCTCCGATGAGGTTCCCAGG - Intronic
1085528098 11:77175661-77175683 AGTGCTCTGACCCCACTCCCAGG - Intronic
1087297811 11:96398068-96398090 AGGGCCCTCACCAGATGCCAGGG + Intronic
1088710040 11:112499645-112499667 AAGGCTCTGACAAGCTACCCAGG + Intergenic
1089631671 11:119788145-119788167 AGGGTGCTGACCAGAGGCCCAGG - Intergenic
1089708449 11:120298070-120298092 AGGCCTCTGCCCAGCTGCCCTGG + Intronic
1093985647 12:25529229-25529251 AGGGCTAAGAACAGAATCCCAGG - Intronic
1095868863 12:47003569-47003591 GGGGCTTAGACCAGAATCCCTGG - Intergenic
1097167783 12:57094791-57094813 AGGGTTGTGACTAGATTCCGGGG - Exonic
1099758929 12:86893336-86893358 AGGACGCTGGCCAGATTCTCAGG - Intergenic
1100544800 12:95591349-95591371 AGGGCTGGGACAAGGTTCCCAGG + Intergenic
1101917055 12:108903924-108903946 AGGACTCTGACAAGGATCCCAGG + Intergenic
1103858991 12:123996742-123996764 AGGGCTCTGTCCTCATTGCCTGG + Intronic
1105512619 13:21062838-21062860 AGAGATCTGAGAAGATTCCCTGG - Intergenic
1106601164 13:31188250-31188272 AGGGCTGGCAGCAGATTCCCTGG - Intergenic
1107198500 13:37683659-37683681 AGAGCTCTGACCAGGGTGCCAGG + Intronic
1107430781 13:40338387-40338409 GGGCCTCTGACCTGATTCCTTGG - Intergenic
1109672806 13:65632277-65632299 AAGGCTTTGACCAGATTCCCAGG - Intergenic
1110915220 13:81012490-81012512 ATGGCTCTGACCAATTTCTCTGG + Intergenic
1121570074 14:94940763-94940785 AGGGGGCTGAGCAGAATCCCGGG - Intergenic
1121719388 14:96098650-96098672 AGTGCACTGCCCAGATGCCCTGG + Intergenic
1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG + Intronic
1125999178 15:44194092-44194114 AGGGCTGTGACTGCATTCCCGGG + Intronic
1126734131 15:51714475-51714497 AGGATTCTGACACGATTCCCAGG + Intronic
1127350036 15:58142084-58142106 TGGGCTCTGGGCTGATTCCCGGG - Intronic
1131138540 15:89958334-89958356 ATGGGGCTGGCCAGATTCCCAGG + Intergenic
1131848016 15:96508805-96508827 AGGGCACTGTTCAGATTCCCAGG - Intergenic
1133119664 16:3598318-3598340 ATGGCTCTGAGCAGGCTCCCTGG + Intronic
1134291994 16:12909073-12909095 AAGGCTTTGACCAGCTTCCCAGG + Intronic
1134471553 16:14530776-14530798 AGGGCTTTGAGGAGATGCCCTGG - Intronic
1136923992 16:34354183-34354205 AGGGCTATGAATAGATTGCCAGG + Intergenic
1136980581 16:35057623-35057645 AGGGCTATGAATAGATTGCCAGG - Intergenic
1137259523 16:46813034-46813056 AGGGCTCTGGACAGAATCCTGGG - Intronic
1138517405 16:57543807-57543829 AGGGCTCTGATCAAAGTCCTTGG - Intronic
1139136816 16:64214536-64214558 AGGAGTCTGAGCAGATTCCGAGG - Intergenic
1141150078 16:81558507-81558529 AGGGCACTGAGCAGTATCCCTGG - Intronic
1141178811 16:81738611-81738633 AGGGTGCTGAACAGCTTCCCTGG + Intergenic
1142964369 17:3571668-3571690 AGAGCTGTGCCCAGCTTCCCGGG + Intronic
1143918962 17:10315616-10315638 ACTGCTCTGACCAGCTTCACGGG + Intronic
1144668900 17:17120399-17120421 TGGCCTCTGACAAGATGCCCTGG + Intronic
1145188498 17:20817557-20817579 AGGGCTGTGACCAGATCACTGGG + Intergenic
1147048568 17:37773221-37773243 AGGGCAGTGACCACATCCCCAGG - Intergenic
1147865539 17:43549611-43549633 TGAGCTCTGACCTGTTTCCCAGG + Intronic
1148988947 17:51648669-51648691 AGGACTCTGTCCAGTTTCCTTGG - Intronic
1149622297 17:58054934-58054956 GGAGCACTGACCAGATTCCAGGG + Intergenic
1150078408 17:62214103-62214125 AGGGCTGTGACCAGATCACTGGG - Intergenic
1151927995 17:77212973-77212995 AGGGCTCAGCACAGCTTCCCTGG - Intronic
1152240298 17:79157408-79157430 AGGGTCCTGATCAGATTCCGGGG - Intronic
1152255100 17:79234370-79234392 TGGGCACTGACCAGATGGCCTGG - Intronic
1152608790 17:81305744-81305766 AGGGCTCTGCCCAGAGCCTCTGG + Intergenic
1154359302 18:13645640-13645662 AGGAATCAGACCAGGTTCCCAGG - Exonic
1155133365 18:22961793-22961815 AAGCTTCTGAGCAGATTCCCGGG + Intronic
1158322885 18:56282660-56282682 AGTGCCCTGCCCATATTCCCAGG + Intergenic
1158503363 18:58023653-58023675 AGGGAGATGACCAGAATCCCTGG - Intergenic
1160701753 19:510873-510895 AGGGCCCTGAGCAGCGTCCCTGG + Intronic
1160779685 19:872282-872304 AGGGCTCTGAGCAGCGTCCCCGG - Intronic
1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG + Intronic
1161072161 19:2267975-2267997 AGGGCGCTGAGCAGCGTCCCTGG - Intronic
1161138108 19:2632650-2632672 AGGGTGCTGAGCAGAGTCCCTGG + Intronic
1161163830 19:2774971-2774993 AGGGCACTGAGCAGCGTCCCTGG - Intronic
1161281150 19:3446419-3446441 AGGGTGCTGAGCAGAGTCCCTGG - Intronic
1161572388 19:5037701-5037723 AGGGTGCTGAGCAGCTTCCCTGG + Intronic
1163700482 19:18784374-18784396 AGGTCTCTGACCACCTTTCCTGG - Intronic
1167117307 19:47495779-47495801 AGCCCTCTCACCAGATTTCCTGG - Intronic
1167567296 19:50264722-50264744 AGAGCTCCAGCCAGATTCCCAGG + Intronic
1167899103 19:52605098-52605120 AGGGCTCTGTGCAGTATCCCGGG - Intronic
925477149 2:4230116-4230138 AAGGCTCTGGCCACATTCACAGG + Intergenic
926652009 2:15357037-15357059 AGGGATTTGATCAGATTACCAGG - Intronic
926753552 2:16218743-16218765 AGGGCTTTCTCCAGAGTCCCTGG + Intergenic
928211982 2:29330150-29330172 AGGGCTCAGATATGATTCCCTGG - Intronic
929446871 2:42008970-42008992 AGGGCTCTGACAAGGTTCCTGGG - Intergenic
931704762 2:64938117-64938139 CGGGCTCTGACCAGAGTGCCAGG + Intergenic
934491058 2:94762279-94762301 AGGTCTCAGGCCAGGTTCCCTGG + Intergenic
935696109 2:105772406-105772428 AGGACTATGCCCACATTCCCCGG - Intronic
936555867 2:113498561-113498583 AAGGTTCTGACAATATTCCCAGG - Intergenic
938727910 2:134122852-134122874 AGGGCTCTGCCCAGATCTGCCGG + Intronic
940638818 2:156327906-156327928 AGGGCACTGATCAGACTCACCGG + Exonic
942903746 2:181156303-181156325 AAGGCTCAGACAAGCTTCCCTGG - Intergenic
943764527 2:191646347-191646369 AGTGCTCTGACTGGATTCCCTGG - Intergenic
945270459 2:207933596-207933618 AGGGCACTGGCCAGTCTCCCAGG + Intronic
946124620 2:217551717-217551739 ACAGCTCTGCCCAGATTCCTAGG - Intronic
946231516 2:218294228-218294250 AGGGATCTGGACAGATTCCATGG - Intronic
948252888 2:236544661-236544683 GGGGCTCAGCCCAGAATCCCGGG - Intergenic
948863942 2:240766064-240766086 AGGGCCCTGTCCAGCTCCCCAGG + Intronic
949036223 2:241816799-241816821 AGGGCTCTGTCCAGCTGCGCGGG - Exonic
949043027 2:241858111-241858133 GGGTCTCTGCCCAGATTCCAGGG - Intronic
1168853303 20:991129-991151 AGGGGTCTCACCACATTGCCCGG + Intronic
1169316161 20:4592634-4592656 AGGGCTCTGAGGAAATGCCCCGG + Intergenic
1170367302 20:15611828-15611850 AAGGCTCCGAGCAAATTCCCGGG + Intronic
1171192242 20:23166825-23166847 AGGGCTCTGCCCAACTTCCCAGG - Intergenic
1171449296 20:25224778-25224800 AAGGCTTTGAGCAGAATCCCAGG + Intronic
1172097727 20:32468409-32468431 ACGCCTCTGCCCAGCTTCCCAGG + Intronic
1172603449 20:36199193-36199215 AAGGTTCTGAGCAGGTTCCCAGG - Intronic
1173105708 20:40131978-40132000 GGGGATCAGATCAGATTCCCTGG - Intergenic
1174423732 20:50417354-50417376 AGGGCACTGAACAGCATCCCTGG - Intergenic
1175316902 20:58054941-58054963 AGAGCTTTGATCAGATTCTCTGG - Intergenic
1175660599 20:60808918-60808940 GGGGCTCTGCCCAGACACCCAGG - Intergenic
1175660636 20:60809048-60809070 AGAGCTCTGCCCAGACACCCAGG - Intergenic
1176093811 20:63330446-63330468 TGGGCTCTGACCTGATTCTTGGG - Intronic
1178030836 21:28523644-28523666 AAGGATCTGACCAAATGCCCAGG - Intergenic
1180945221 22:19688852-19688874 AGGGCTCTGGCCAGAAAACCAGG - Intergenic
1181025292 22:20124245-20124267 ATGGCTCTGCCCAGATGCCCAGG - Intronic
1181439889 22:22930328-22930350 TGGGCTCTGCCCAGAGACCCAGG + Intergenic
1182038484 22:27217994-27218016 TGGGCTCTGATCACTTTCCCTGG + Intergenic
1183261483 22:36798527-36798549 AGGGCTCTGACCTGGTTTCCGGG + Intergenic
1184694289 22:46131154-46131176 AGGCCTCTGGCCCCATTCCCAGG + Intergenic
1184927735 22:47655865-47655887 AGAGCTCTTAGCAGACTCCCTGG + Intergenic
949353511 3:3151780-3151802 AGGGAACTGAACAGGTTCCCAGG + Intronic
951217608 3:20040139-20040161 AGGGCGCGGAGCAGAGTCCCGGG + Exonic
951658586 3:25036819-25036841 GGGGATCTGGCCAGATTCTCTGG + Intergenic
954573586 3:51662579-51662601 GGAGCTCTGACGGGATTCCCGGG - Exonic
954659319 3:52218563-52218585 AGGACTCAGGCCAGATTGCCTGG - Intergenic
954687940 3:52380604-52380626 AGGGCTCTGACCCAACTCTCAGG + Intronic
954805440 3:53217306-53217328 TGGGCTCTTACCAGATGCCTGGG + Intergenic
954875897 3:53803061-53803083 AGGGATCAGAGCAGATGCCCTGG + Intronic
958714226 3:97759906-97759928 AGGACTCTTACCAGAGTCCTTGG - Intergenic
959460344 3:106617833-106617855 AGGCATCTGACCTGATTCACAGG + Intergenic
960602991 3:119476717-119476739 AGCTTTCTGACTAGATTCCCTGG - Intronic
961779495 3:129313431-129313453 AGCCTTCTGACCAGATCCCCAGG - Intergenic
966864989 3:184253287-184253309 AGTGTTCTGACCAGATGCCCTGG - Intronic
967949574 3:194830443-194830465 AGGGCTCTGTCCAGCATACCTGG - Intergenic
968788674 4:2643795-2643817 ACGGCTCTGCTCAGATCCCCTGG + Intronic
975861893 4:78686219-78686241 AGGGCTCTGCCCTGATTCTGTGG - Intergenic
978646951 4:110945551-110945573 TGGGCTTTCACCAGATTCACAGG - Intergenic
980771627 4:137380532-137380554 ATGCCCCTGACCAGATGCCCAGG - Intergenic
985608286 5:871050-871072 AGGGGTCTCTCCAGGTTCCCAGG + Intronic
987555336 5:19439532-19439554 ATGGCTATTATCAGATTCCCAGG + Intergenic
987789849 5:22551071-22551093 AAGGCTCTGACAAGATTCCAAGG - Intronic
988496109 5:31747634-31747656 GGGGCTCTGGCCAGCTTCCCGGG + Intronic
1001229077 5:169970380-169970402 AGGGGGCTGTCCAGATGCCCAGG - Intronic
1001266618 5:170278652-170278674 AGGGCTCTGACCAGCTCACAAGG + Intronic
1005510260 6:26506204-26506226 AGGGCTCTGTCTAGGTTTCCAGG + Intronic
1007163085 6:39808658-39808680 TGGGCTCAGACCAGATTTCAAGG - Intronic
1008960421 6:57260651-57260673 ATGGCTTTGCCCAGAGTCCCTGG - Intergenic
1010021536 6:71165304-71165326 TGGGCTTTCACCAGATTCACAGG + Intergenic
1010169588 6:72959247-72959269 AAGGCCCTGGGCAGATTCCCAGG - Intronic
1010320609 6:74504619-74504641 AGGGCTGGTACTAGATTCCCAGG - Intergenic
1010619997 6:78062361-78062383 ATGGCTGTGACCAGAATCCTAGG - Intergenic
1011559743 6:88602582-88602604 AGGGCCCTTCCCAGACTCCCAGG + Intergenic
1013167210 6:107605021-107605043 AGGGCTCTGAGCAGACTGACAGG - Intronic
1018941083 6:168309080-168309102 AGGGCTCTGTCAAGATCACCTGG + Exonic
1018993891 6:168695872-168695894 AGGGCTCTCAACGGATCCCCAGG + Intergenic
1019440809 7:1045531-1045553 ATGGTTCTGACCATGTTCCCAGG + Intronic
1031560307 7:123230510-123230532 TGGGCTTTCACCAGATTCCCAGG - Intergenic
1037245158 8:16826137-16826159 AGGGCTCTGACCTAATTTCTGGG + Intergenic
1039860426 8:41452839-41452861 AGGGCTCTGGACACATTCCATGG - Intergenic
1040493188 8:47943498-47943520 AGAGCTCTGACAGGAATCCCTGG - Intronic
1041063893 8:54062290-54062312 TGGGCTTTCACCAGATTCACAGG - Exonic
1043912661 8:85881072-85881094 AGGGCAATGCCCAGATTTCCAGG + Intergenic
1047297590 8:123584925-123584947 TGGGCTCTGACCAGTTTGCCTGG + Intergenic
1047613696 8:126545344-126545366 AGGTGTCTGCCCACATTCCCTGG - Intergenic
1049897156 9:118792-118814 AAGGTTCTGACAATATTCCCAGG + Intergenic
1050547642 9:6722206-6722228 AGGGCTGTGATAAGACTCCCTGG + Intronic
1051148945 9:14060022-14060044 AGGGCCCTCACCAGAATCCAGGG - Intergenic
1051775175 9:20624138-20624160 AGTGGTCCGACCTGATTCCCAGG - Intergenic
1053740259 9:41129057-41129079 AAGGTTCTGACAATATTCCCAGG + Intergenic
1054443221 9:65285050-65285072 AAGGTTCTGACAATATTCCCAGG + Exonic
1054487059 9:65736451-65736473 AAGGTTCTGACAATATTCCCAGG - Intergenic
1054688090 9:68302256-68302278 AAGGTTCTGACAATATTCCCAGG - Intergenic
1055445651 9:76379699-76379721 AGGGCACTGAGCGGATTCCCAGG - Intergenic
1055978509 9:81977162-81977184 AGGGCTCTGAGCGGTTTCCGAGG - Intergenic
1056951596 9:91044562-91044584 GGGGCTCTGCCCAGCATCCCTGG - Intergenic
1057031011 9:91775324-91775346 ATGGCTCTGACCACAGGCCCAGG + Intronic
1059415263 9:114158250-114158272 AGGGCTCTGAGCTGAGACCCAGG - Intronic
1060431134 9:123552275-123552297 AGGGTTCTGCCCATCTTCCCAGG + Intronic
1060513031 9:124248193-124248215 GGGGCTCTGCCAAGACTCCCTGG + Intergenic
1060888918 9:127175988-127176010 AAGGCTCTGCCCTGATTCCCAGG + Intronic
1061191168 9:129083560-129083582 AGGGCTGAGCCCAGATTCCAGGG - Intronic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1062349058 9:136130246-136130268 AGGGCCCTGAGCAGAATCACAGG + Intergenic
1062530111 9:136995989-136996011 CAGGCTCTGACAAGATTCCAGGG - Intronic
1185633010 X:1529531-1529553 AGGGCACTGAGCATCTTCCCAGG - Intronic
1185641440 X:1591391-1591413 AGGGCTATGACCACAGACCCTGG + Intergenic
1187722489 X:22165692-22165714 AGGGCTCTGACCAGATTCCCTGG - Intronic
1190075629 X:47314961-47314983 AGGGCTCTAGCCAGGTGCCCTGG - Intergenic
1190303327 X:49068641-49068663 AGGGGTCAGACCAGTGTCCCCGG - Exonic
1199548881 X:149036477-149036499 AGTGCTCTGTTCTGATTCCCAGG - Intergenic
1202244163 Y:22799764-22799786 AGATCTCTGACCAGATTCACTGG - Intergenic
1202397151 Y:24433514-24433536 AGATCTCTGACCAGATTCACTGG - Intergenic
1202473630 Y:25236578-25236600 AGATCTCTGACCAGATTCACTGG + Intergenic