ID: 1187724732

View in Genome Browser
Species Human (GRCh38)
Location X:22190608-22190630
Sequence CAGGGTATGCTGGTGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187724722_1187724732 26 Left 1187724722 X:22190559-22190581 CCATGACTATGATGGAGGGTAAG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1187724732 X:22190608-22190630 CAGGGTATGCTGGTGAAGGAAGG 0: 1
1: 0
2: 5
3: 32
4: 279
1187724726_1187724732 -10 Left 1187724726 X:22190595-22190617 CCCCCAAAAGTGGCAGGGTATGC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1187724732 X:22190608-22190630 CAGGGTATGCTGGTGAAGGAAGG 0: 1
1: 0
2: 5
3: 32
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187724732 Original CRISPR CAGGGTATGCTGGTGAAGGA AGG Intronic
900124135 1:1062105-1062127 GAGGGAATGGTGGTGAGGGAGGG - Intergenic
900351701 1:2238115-2238137 CAGGGCCAGCTGGTGAGGGAGGG - Intronic
900540986 1:3202571-3202593 AAGGGTCTGCAGGTGAAGGATGG + Intronic
900910395 1:5593351-5593373 CAGGGTTTGCTCTTTAAGGAGGG + Intergenic
901466548 1:9425397-9425419 CAGTGCACGCTGCTGAAGGATGG + Intergenic
901534420 1:9873026-9873048 CAGGGTTTGCTGGTCCTGGAGGG - Intronic
901740311 1:11337978-11338000 CAGGCTCTTCAGGTGAAGGAAGG - Intergenic
902104002 1:14018359-14018381 CAGGGTACGGGGGAGAAGGAGGG + Intergenic
902187952 1:14739568-14739590 CAGGCTAGGCTGATGAAGGGAGG + Intronic
902526347 1:17060245-17060267 GAGAGTATGCTGGTGACGGCAGG - Intergenic
902623272 1:17662681-17662703 CAGGGTATGGTAGGGAAGGATGG + Intronic
903719205 1:25391892-25391914 CAGGGGAAGTTGGTAAAGGAGGG + Intronic
904396003 1:30222743-30222765 CAGGGTAAGATGGTGGAGTAGGG - Intergenic
904652716 1:32018020-32018042 CACTGTATGCTTTTGAAGGATGG - Intronic
905282968 1:36860685-36860707 CAGGGTGGGCTGGTGAAGGAAGG + Intronic
905441026 1:37996692-37996714 CAGGGTATAATGGGGAAGGAAGG - Intergenic
905643547 1:39608975-39608997 CTGGGAGTGCTGGTGGAGGAAGG + Intergenic
906220053 1:44071476-44071498 CAGGGAAGGCTGGAGAAGGAAGG - Intergenic
911287577 1:96015493-96015515 GAGGGTTTGATGGTGGAGGATGG - Intergenic
911380445 1:97107215-97107237 CAGGGGATGGTGATAAAGGAGGG - Intronic
911537250 1:99115178-99115200 CAGGGTTTGCTGGTTAAATAGGG + Intergenic
912694070 1:111827801-111827823 CAGGGTATCCTGGAGCAGGAGGG - Intronic
913564111 1:120054224-120054246 CTGAGCATGCAGGTGAAGGACGG + Intronic
915167441 1:153956239-153956261 CAGGGAAGCCTGGAGAAGGAGGG + Intronic
916449554 1:164907001-164907023 CAGGGTGTGGAGTTGAAGGAGGG - Intergenic
918315185 1:183317242-183317264 CAGGGTATGCTGGAGGATGTGGG - Intronic
919481583 1:198096624-198096646 GAGGGTAGGGTGGAGAAGGAGGG + Intergenic
920379530 1:205527664-205527686 CAGGGTGTGCAGGAGAATGAGGG + Intronic
923136184 1:231121716-231121738 CTGGGGATGCTGGGGCAGGAGGG + Intergenic
923799861 1:237197965-237197987 CAGGATGTGCTGCTTAAGGAAGG + Intronic
1062778874 10:182366-182388 AAGGCTATGCTGATGAAGAAAGG - Intronic
1062983746 10:1747337-1747359 GAGGGTAAGGTGGTGAGGGATGG + Intergenic
1064110778 10:12536863-12536885 CAGAGTATTCTGCTGAATGACGG + Intronic
1065522240 10:26584228-26584250 CAGGGTATGGGGGTGATGCAGGG + Intergenic
1067144017 10:43680601-43680623 CAGGGGCTGGGGGTGAAGGAAGG - Intergenic
1067428237 10:46225370-46225392 CAGGGAATCCTGGTGAGAGATGG + Intergenic
1071504824 10:86226322-86226344 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504831 10:86226340-86226362 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504859 10:86226416-86226438 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504866 10:86226434-86226456 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504880 10:86226470-86226492 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504936 10:86226630-86226652 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1073070997 10:100793234-100793256 CAGGGGCTGGTGGGGAAGGAGGG - Intronic
1073419751 10:103415029-103415051 TATGGGATGCTGGTGAAGGTGGG + Exonic
1073774128 10:106767172-106767194 CAGGCTTTGCTGATGAAGGCTGG + Intronic
1074350734 10:112734255-112734277 CATGGTATACAGGTGAGGGATGG - Intronic
1074532246 10:114305657-114305679 GAGGGGATGCAGGTGCAGGAGGG + Intronic
1074789775 10:116875260-116875282 CTGTGTATGCTGGTGTAGAATGG - Intronic
1074828130 10:117229152-117229174 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1074828586 10:117232280-117232302 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1077146825 11:1050196-1050218 CAGGGGACCCTGGTGCAGGAGGG + Intergenic
1077211930 11:1375159-1375181 CAGGCTGTGCTGGAGAAAGATGG - Intergenic
1077482788 11:2824359-2824381 CTGGATATGGTGGTGAAGGAGGG + Intronic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078726051 11:13931789-13931811 GAGAGTATGCTGGGGAAGAAGGG + Intergenic
1079283780 11:19110619-19110641 TAGGGCAGGCTGGTGATGGAAGG + Intergenic
1080054589 11:27892936-27892958 CAGGTTCTGCTGGTATAGGAAGG - Intergenic
1080409692 11:32011890-32011912 CAGGCCATGCTAATGAAGGAAGG + Intronic
1084964631 11:72738266-72738288 CAGACTATGCAGGTGACGGAGGG - Intronic
1085307078 11:75492475-75492497 TAGTGGAAGCTGGTGAAGGAAGG + Intronic
1085690372 11:78659428-78659450 CAAGGGCTGCTGGAGAAGGAAGG + Intronic
1088243400 11:107793272-107793294 CCATGTATGCTGGTGAATGATGG + Intronic
1088994290 11:114982994-114983016 CAGGGCATGCTAGTGTAGCAGGG - Intergenic
1090715321 11:129425400-129425422 CAGGGAGTGCTTGTGAAGCATGG + Intronic
1090944085 11:131414146-131414168 CAGGGTATTCTGGTGAAAGGTGG + Intronic
1090951435 11:131476876-131476898 CGGGGTATGGTGGTGAAGGCTGG - Intronic
1091132159 11:133155566-133155588 CTGGGTATGCGGGTGAAGTAAGG - Intronic
1092214764 12:6673215-6673237 CCGGGTGTGCTGCTGAAGGTGGG + Exonic
1092239217 12:6827179-6827201 CAGGGTCAGCTGGGGAAAGATGG - Exonic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1098498887 12:71167403-71167425 CTGAGTATGCTGGAGAAAGAAGG + Intronic
1102711607 12:114932898-114932920 CCGGGTATGCTGTTGAGGGATGG - Intergenic
1102938915 12:116921031-116921053 CTGGGTGTGGTGGTGAAGGAGGG - Intronic
1105479609 13:20762292-20762314 CTGGGGATGCTGCTGAAGCAGGG - Intronic
1105855865 13:24371346-24371368 GAGGGTGAGCTGATGAAGGAGGG + Intergenic
1106102426 13:26706612-26706634 CAGGGGCTGCTGGTGAAGGCGGG - Intergenic
1110267946 13:73559615-73559637 GAGTGTATGCTGATGAAGCAAGG - Intergenic
1111463707 13:88579757-88579779 TAGGGTTTTCTGGTCAAGGATGG - Intergenic
1115524661 14:34267709-34267731 CAGGTCAAGGTGGTGAAGGATGG - Intronic
1118486036 14:66215329-66215351 CAGGTTATGCTGATGCAAGAGGG + Intergenic
1119145576 14:72310745-72310767 CAGGGGAGGCTGGTGGTGGAAGG - Intronic
1119186117 14:72643699-72643721 CAGGGAAAGCTGGTGATGGGCGG - Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1122274209 14:100583000-100583022 CAGGGGTGGATGGTGAAGGACGG - Intronic
1124010081 15:25831080-25831102 CAGGGCATGGTGGGGAAGGTGGG - Intronic
1125542919 15:40481540-40481562 CAGGGGATGGTGGGGAGGGAGGG - Intergenic
1126353546 15:47770896-47770918 CAGGGTCTTCTGGTGAAGCACGG - Exonic
1126994337 15:54422723-54422745 CAGGGTAGGGTTGTGAACGAAGG - Intronic
1129318929 15:74763040-74763062 CAGGGCATGCTGTTGAGGGCTGG + Intergenic
1129673636 15:77620809-77620831 CAGGGTCTCAGGGTGAAGGACGG + Intronic
1129888329 15:79054262-79054284 AAGGGGAGGTTGGTGAAGGATGG + Intronic
1130712043 15:86292883-86292905 AAGGTTATGCTGATGAAGGTTGG + Intronic
1132599226 16:766599-766621 GAGGTTATGCTGGTGGTGGAGGG + Intronic
1132888985 16:2195225-2195247 CATGGGCTGCTGGTGAAGTACGG + Intronic
1133835698 16:9365542-9365564 CAGGAGAGGCTGGTGCAGGAAGG + Intergenic
1134196923 16:12166436-12166458 CAGGTTAACATGGTGAAGGAAGG + Intronic
1134267595 16:12705238-12705260 TAAGGTATCCTGGGGAAGGATGG - Intronic
1135540392 16:23325407-23325429 CTGGGCATGGTGGTGCAGGAAGG - Intronic
1136056970 16:27697502-27697524 CTGGGTATGTGGGTGAAGGGTGG - Intronic
1136236127 16:28914636-28914658 CAGGGGGCGCTGGGGAAGGAGGG - Intronic
1136238793 16:28931944-28931966 CAGGGGATGCTGGGGCAGGCAGG - Exonic
1137531422 16:49281152-49281174 CAGATTGGGCTGGTGAAGGAGGG - Intronic
1139348837 16:66322704-66322726 CAGGGAATGATGGGGAAGGGAGG + Intergenic
1139431878 16:66915186-66915208 CGGGGTGTGCTGGGGAGGGAGGG - Intronic
1141125484 16:81397918-81397940 CAGGAATTGCTGGTGAAGGCAGG - Intergenic
1141603901 16:85142338-85142360 CAGAGGATGCTGGAGAAGCAGGG - Intergenic
1141964768 16:87434444-87434466 CAGCGAAGGCTGGTGGAGGAAGG - Intronic
1142414575 16:89934424-89934446 GAAGGTATGCTGGAGCAGGAGGG + Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142688294 17:1590593-1590615 CAGGGTTTCCTGGTCCAGGAGGG - Intronic
1143098764 17:4493193-4493215 CACGGTCTGTTGGTGAAGGGCGG + Intergenic
1143286420 17:5793087-5793109 CAGGGTATACTTGGGTAGGAAGG + Intronic
1143897562 17:10148264-10148286 CAAGGGATGCAGGTGAAGAAAGG - Intronic
1144393316 17:14817093-14817115 AATGGCATTCTGGTGAAGGAGGG + Intergenic
1145012257 17:19376289-19376311 TAGGGTGTGCTGGCCAAGGAGGG - Intronic
1145982492 17:29021372-29021394 CAGGATAAGCTGATAAAGGAAGG - Intronic
1146741258 17:35285736-35285758 CAGAGCAGGCTGGAGAAGGATGG - Intergenic
1147522747 17:41190118-41190140 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147526284 17:41226886-41226908 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147527319 17:41238253-41238275 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147528444 17:41249937-41249959 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147529873 17:41265609-41265631 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147530455 17:41271542-41271564 CAGGGTGTGCTGCAGCAGGAAGG - Intergenic
1147530868 17:41275914-41275936 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1149560467 17:57604703-57604725 CAGGGGATTCTGGGGAAGGAAGG + Intronic
1149688047 17:58549781-58549803 CAGGGTAAGCTGTTGGTGGAAGG + Intergenic
1150599879 17:66641517-66641539 CAGGGTTTGCTGAGCAAGGAAGG + Intronic
1150638310 17:66932084-66932106 CAGGGTGAGCTGGTGAAGGAAGG - Intergenic
1151175203 17:72282422-72282444 GAGGGTGTGCGGGTGAAGGGTGG - Intergenic
1152323851 17:79624343-79624365 CAGGGGAGGCTGGGGAAGGGAGG + Intergenic
1152428243 17:80230572-80230594 CAGGCCAGGCTGGTGGAGGAAGG + Intronic
1153761369 18:8335251-8335273 CAGGGTATGACTCTGAAGGAGGG - Intronic
1155913867 18:31536838-31536860 CAGGGAATAATGTTGAAGGAAGG - Intronic
1156459688 18:37314771-37314793 CAAGGTAGGCAGGTGAAGGCAGG - Intronic
1156483736 18:37451898-37451920 CTAGGTTTGCTGGTGGAGGAGGG - Intronic
1157837742 18:50923143-50923165 CAGGGAATTCTGGTTAAAGATGG - Intronic
1158519791 18:58162334-58162356 GGGGGGAAGCTGGTGAAGGATGG - Intronic
1158689394 18:59646468-59646490 CAGGGCATGCTGGTGAGAGACGG + Intronic
1159544234 18:69818890-69818912 CAGGTTTTGCTGGTGATGGTGGG - Intronic
1163284444 19:16337846-16337868 CAGGGGATGCTGTTGTGGGAGGG - Intergenic
1165419612 19:35716442-35716464 AAGGGGAGGCCGGTGAAGGAAGG - Intronic
1165484929 19:36089869-36089891 CAGGGAATACGGGTGAATGAGGG - Intronic
1166758665 19:45211352-45211374 CTGGGTATGGTGGTGGTGGAGGG + Intronic
1166934311 19:46321800-46321822 CAGGGAAGGCGGGTGCAGGAAGG - Exonic
1168105035 19:54161252-54161274 GAGGGTAAGCTGGTGGGGGAAGG + Exonic
1168398264 19:56066886-56066908 CTGGGTGTGCTGGTGAGGGAGGG - Intergenic
925717633 2:6799018-6799040 CAGGGAATGCTGGTCAAGCCTGG + Intergenic
925777176 2:7347014-7347036 CAGAGTCTGCTGGAGATGGATGG + Intergenic
926973033 2:18485688-18485710 CAGGGAAACCTGGGGAAGGAGGG - Intergenic
928748632 2:34445357-34445379 CAGGAAATGCTTGGGAAGGAGGG - Intergenic
932697717 2:73970611-73970633 CAGGATGTGATGGTGAAGGGTGG + Intergenic
932822788 2:74915628-74915650 CAGGCTCTGCTGGGGCAGGAGGG + Intergenic
933630553 2:84651431-84651453 CAGTGTCTGCTGGTGAGGGTAGG + Intronic
934039477 2:88116018-88116040 CAGGAGAGGCTGGTGCAGGATGG + Intergenic
936252461 2:110877145-110877167 CTGGCTGTGCTGGAGAAGGAGGG - Intronic
940170768 2:150827756-150827778 CAGGGTATGCTAGTGCTGAAGGG - Intergenic
941312834 2:163955479-163955501 GAGGTCATGCTGGTGTAGGATGG - Intergenic
941984017 2:171491713-171491735 CAGGAGTTGCTGGTAAAGGAAGG + Intergenic
942612253 2:177754577-177754599 CAGGGGAGGAAGGTGAAGGAAGG - Intronic
942654029 2:178195415-178195437 CCGGGGATGCTGGGGGAGGAGGG + Intronic
943581342 2:189687109-189687131 CAGGGAATGGTGGGGCAGGAGGG - Intronic
944739624 2:202599136-202599158 CAGGGTATGGTGGCTCAGGATGG - Intergenic
945719176 2:213397402-213397424 AAGGGTATGTTCATGAAGGAGGG - Intronic
947835538 2:233172212-233172234 CTGTGCAGGCTGGTGAAGGATGG + Intronic
1168948138 20:1778417-1778439 CATTGGATGATGGTGAAGGAAGG - Intergenic
1169746156 20:8945241-8945263 GAGGGTGTGCTGATGATGGAAGG + Intronic
1170773193 20:19352014-19352036 CAGGGGATACCGATGAAGGAGGG + Intronic
1173644881 20:44627033-44627055 CAGGGAATGAGGGAGAAGGAAGG - Intronic
1175200567 20:57274175-57274197 CAGGGACTGATGGTGAAGAAGGG - Intergenic
1175337058 20:58203523-58203545 CAGAGTGGTCTGGTGAAGGATGG + Intergenic
1175669196 20:60887190-60887212 CTGGGTTTGCTGCTGAAGGAAGG + Intergenic
1175869012 20:62198640-62198662 GTGGGCACGCTGGTGAAGGAGGG + Exonic
1175892876 20:62323106-62323128 GAGGGTCTGATGGTGAAGGTGGG + Intronic
1176000339 20:62828761-62828783 CAGGGCATGCCGGGCAAGGACGG + Exonic
1177083922 21:16677857-16677879 CAGCCTATGCTTTTGAAGGAGGG - Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1179409028 21:41147926-41147948 CAGGCTATGGTGGTGTAGGGAGG + Intergenic
1179944887 21:44666483-44666505 CAGAGGACGCTGGTGCAGGAGGG + Exonic
1179946533 21:44681870-44681892 CAGAGGACGCTGGTGCAGGAAGG + Exonic
1180117859 21:45723965-45723987 CAGCTTATGCTGGAGGAGGACGG - Intronic
1180148902 21:45937691-45937713 CAGGGTTTGCAGGTGCAGGTGGG + Intronic
1180210357 21:46292300-46292322 CAGGGCAAGCTGGGGAAGCAAGG + Intronic
1180256707 21:46635016-46635038 CAGGGTCCCCTGGTAAAGGAGGG + Intergenic
1180580609 22:16832519-16832541 AAGGGTATGCTTGTCAAGTAGGG - Intergenic
1181836541 22:25614921-25614943 CAGGGTGAGCTGGTTAGGGATGG - Intronic
1181990302 22:26832118-26832140 CAGGGCTGGATGGTGAAGGATGG - Intergenic
1182647320 22:31820821-31820843 CAGGGAACCCTGATGAAGGAGGG - Intronic
1183279066 22:36922576-36922598 GAGTGTCTGCTGGGGAAGGAGGG - Intronic
1184248838 22:43249013-43249035 CAGGGGGTGCTGGTGGAGGAAGG + Intronic
1184912705 22:47547084-47547106 CAGGGCAGCCGGGTGAAGGAGGG - Intergenic
950930809 3:16787010-16787032 CAGGAAGTGCTGGTAAAGGAGGG - Intergenic
950969105 3:17168650-17168672 GAGGATGTGCTGGTGGAGGAAGG + Intronic
951775992 3:26310907-26310929 ACTGGTATGCAGGTGAAGGAAGG - Intergenic
954848357 3:53578982-53579004 ATGGGTATGCTGGGGATGGAGGG + Intronic
955813630 3:62819011-62819033 CAGGGGATGGTGGTGGAGGTGGG + Intronic
955827577 3:62964716-62964738 CAGGTTATGCTTGTTGAGGAGGG + Intergenic
955881452 3:63550895-63550917 AAGGGAATGGTGGTGCAGGATGG - Intronic
956047631 3:65213409-65213431 CAGGCTAGCCTGGTGAAAGAGGG + Intergenic
956324936 3:68041801-68041823 TGGGTTATGCTGGTGAAGGAAGG + Intronic
960190915 3:114705190-114705212 CAGGCTGTGGTGGTGAGGGAAGG - Intronic
962368174 3:134799503-134799525 CATGGAATGCTGGCGAGGGAGGG + Intronic
962425620 3:135266786-135266808 TAGTGTATGCTGGAGGAGGAAGG - Intergenic
962928928 3:140019885-140019907 CAGGGGATGCTGGTGCCTGAGGG + Intronic
963081136 3:141394637-141394659 CTGGATAGGCTGGTGAAGGAAGG - Intronic
964840297 3:160986262-160986284 CAGGAGATGCTGGAGAATGAAGG + Intronic
965953869 3:174344512-174344534 CAGGGGAGGCTGGAGAGGGATGG - Intergenic
968671941 4:1856589-1856611 CAGGGGACGCTGGGGATGGAGGG + Intergenic
969543562 4:7809289-7809311 CAGGGGCTGCTGGTAAAGAAAGG - Intronic
969979842 4:11143216-11143238 CATGGTATGATGGTGCAGGAAGG + Intergenic
970154652 4:13129544-13129566 CAGAGAATGCTGCTGAATGAAGG - Intergenic
972765154 4:42146097-42146119 CAGGATTGGCTGGAGAAGGAGGG - Intronic
976229328 4:82824554-82824576 CAGGGTCTGTTGCTGAAGAAAGG + Exonic
977593145 4:98849088-98849110 TAGGGTATCCCGGTAAAGGATGG - Intergenic
980991296 4:139740784-139740806 CAGGGCATGCTGTGGAGGGAAGG + Intronic
981163428 4:141527064-141527086 AAGGCTATGGTGGTGGAGGATGG - Intergenic
983281010 4:165680862-165680884 CAGGGGATAGTGATGAAGGACGG + Intergenic
983759339 4:171385647-171385669 CAGGGCATGGTGGTGAAGGGAGG - Intergenic
986335090 5:6748712-6748734 CTAGATATGTTGGTGAAGGAAGG + Intronic
986615885 5:9617186-9617208 CAGGGAATGCTGGTGTAAGGAGG - Intergenic
987103483 5:14613774-14613796 CAGACTAAGCTGGTGGAGGATGG + Intronic
987172026 5:15269143-15269165 CAGGGTAAGCTGGTTTAGGATGG + Intergenic
987475762 5:18391044-18391066 CAAGATGTGCTGGTGAAAGATGG - Intergenic
987785037 5:22488733-22488755 CAGGGTAAGCAGGTTTAGGATGG - Intronic
988644160 5:33075582-33075604 CAGGGGGTGCTGGGGAGGGAGGG - Intergenic
989509842 5:42273238-42273260 TAGGATATTTTGGTGAAGGAGGG - Intergenic
992488154 5:77215673-77215695 CAGAATATGCTGGTGAGGGCAGG + Intronic
992986889 5:82239544-82239566 CAGGGATTAGTGGTGAAGGAGGG + Intronic
997596222 5:135109025-135109047 GAGGATAGGCTGGAGAAGGAAGG + Intronic
998230207 5:140357066-140357088 CTGGGTAGGCTGGTGAGGGTTGG - Intergenic
1000133569 5:158322673-158322695 CAGGGTATGCTAGTAAAAGGAGG + Intergenic
1001206086 5:169764374-169764396 AAGGGTTTACTGGTTAAGGACGG + Intronic
1002099925 5:176852443-176852465 CAGGGAAAACTGGGGAAGGAAGG - Intronic
1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG + Intergenic
1003241750 6:4351219-4351241 CAGGAGCTGCTGGGGAAGGAGGG - Intergenic
1005105569 6:22221017-22221039 CAGGGTACGCTGGAGAGGCAAGG - Intergenic
1005342137 6:24852845-24852867 CAGGGGAGGCTGGGCAAGGAGGG + Intronic
1005923882 6:30424181-30424203 AAGGGTAGGGTGCTGAAGGAGGG - Intergenic
1005976538 6:30804412-30804434 CAGTGTCAGCTGGTAAAGGAAGG + Intergenic
1006149890 6:31981364-31981386 CTGGGGAGGCTGGTGAAGGAGGG + Exonic
1006156191 6:32014102-32014124 CTGGGGAGGCTGGTGAAGGAGGG + Intergenic
1006415023 6:33898456-33898478 CAGGTTCTGCTGGTGAACCAAGG + Intergenic
1006717957 6:36132105-36132127 AGGGGTTTGCTGGAGAAGGATGG - Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1010194522 6:73225744-73225766 GAGGGTATGGAGGTGCAGGAAGG + Intronic
1011735721 6:90309036-90309058 TAGGGGAGGATGGTGAAGGAGGG + Intergenic
1012773280 6:103469452-103469474 CAGGGTATCTTGGTCATGGAAGG + Intergenic
1012973921 6:105759245-105759267 CTGGTTATTCTGGTTAAGGAGGG - Intergenic
1014015340 6:116523132-116523154 CAGGCTATTCTGGGGAAGGCAGG + Exonic
1014374937 6:120660573-120660595 CATTGTGTGCTGGTGAAGTAAGG + Intergenic
1016100827 6:140098022-140098044 GAGAGTATGTTGGGGAAGGAGGG - Intergenic
1016887962 6:148976538-148976560 CATGGTGTGCAGGTGAAGGGCGG - Intronic
1018036496 6:159886997-159887019 CAGGGCAGGGTGGGGAAGGAGGG - Intergenic
1018426819 6:163690723-163690745 CAGAGTTTGGTGGTGGAGGAGGG + Intergenic
1019706090 7:2497947-2497969 CAGGGTCTGCTGGGGAAGGAGGG + Intergenic
1019761037 7:2813067-2813089 CTGGGTATGGTGGTGAATGCCGG - Intronic
1022905296 7:34849871-34849893 CTGGGAATGGTGGGGAAGGAAGG - Intronic
1023185340 7:37527268-37527290 CAGTGTATGCTGGAGAAGGTGGG + Intergenic
1024589054 7:50865179-50865201 CACGGTATGCAGGTTAATGATGG - Intergenic
1026340534 7:69430421-69430443 CTGGGTTTGCTGGGGAGGGAAGG + Intergenic
1029661525 7:101965437-101965459 CAGGGCATGGTGGTGGGGGAAGG + Intronic
1032326587 7:130934794-130934816 CAGGGCATGCTGGTGACCAAGGG + Intergenic
1034367199 7:150561266-150561288 CAGGGTGAAATGGTGAAGGAGGG + Intergenic
1034457079 7:151176362-151176384 CAGGGTAGGCTGGTGAGGGGTGG + Intronic
1035517795 8:251268-251290 CAGGGAATAGTGGTGGAGGAGGG + Intergenic
1036090310 8:5657931-5657953 CATAGTATATTGGTGAAGGAGGG - Intergenic
1036164509 8:6420035-6420057 TAGGTGATGCTGGTGAGGGAGGG + Intronic
1036409329 8:8484275-8484297 CAGGGGAAGCAGGTTAAGGAAGG - Intergenic
1036490826 8:9223957-9223979 CTCCGTCTGCTGGTGAAGGATGG - Intergenic
1036513662 8:9423358-9423380 CAAGGTATGCTGGTGTTGGCTGG - Intergenic
1037636105 8:20702103-20702125 CTGGGAAAGCTGGGGAAGGAGGG + Intergenic
1039369431 8:36969881-36969903 CAGGGAAGGCTGGGGAAAGAAGG - Intergenic
1039722892 8:40183980-40184002 CAGGGTATGTAGGGGAGGGAGGG + Intergenic
1044865596 8:96568160-96568182 CAGGCTTTGCTGGAGAAAGAGGG - Intronic
1045188051 8:99858089-99858111 CAGAGCCTGCTGGTGAAGGAGGG + Intronic
1046593269 8:116230623-116230645 GAGGGTATGCTTGAGAAAGAAGG + Intergenic
1047418447 8:124685560-124685582 CAGAGTCTGCAGGTGAGGGAAGG + Intronic
1047665812 8:127089920-127089942 CAGGGTTTGGGGGTTAAGGAAGG - Intergenic
1048332482 8:133480097-133480119 CAGGGAAGGATGGGGAAGGAGGG + Intronic
1049235691 8:141511128-141511150 CAGGGAATGATGCTGAAGCAGGG - Intergenic
1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG + Exonic
1052017542 9:23486657-23486679 CAGGGGATTCTGGAGAAGAAAGG + Intergenic
1052864513 9:33456921-33456943 CAGGGGGTGCGGGTGAAGGGTGG + Intergenic
1053624226 9:39852294-39852316 CTGGGAATGATGGTGAAGAAGGG + Intergenic
1053880640 9:42590933-42590955 CTGGGAATGATGGTGAAGAAGGG - Intergenic
1053892028 9:42703399-42703421 CTGGGAATGATGGTGAAGAAGGG + Intergenic
1054219671 9:62398403-62398425 CTGGGAATGATGGTGAAGAAGGG - Intergenic
1054231044 9:62510770-62510792 CTGGGAATGATGGTGAAGAAGGG + Intergenic
1054885661 9:70195591-70195613 CTGGGTAGGATGGAGAAGGATGG - Intronic
1056108550 9:83371958-83371980 CAGGGTTTTCAGGTGAAAGAAGG - Intronic
1056617021 9:88177525-88177547 GAGGGCATGCAGGAGAAGGATGG + Intergenic
1060456659 9:123804941-123804963 AGAGGTATGCTGGTGAAGGGAGG - Intronic
1060886225 9:127154291-127154313 CAGGGTGTCCTGGAGAAGGGTGG + Intronic
1060888727 9:127174916-127174938 CTGGGCAGGCTGGTGCAGGAGGG - Intronic
1061451018 9:130667009-130667031 CAGGGTGTCCGGGGGAAGGAGGG - Intronic
1062320751 9:135989519-135989541 CAGTGTCTGCTGGGCAAGGAGGG + Intergenic
1062431587 9:136528951-136528973 CAGGTCCTGCTGGTGAGGGAGGG - Intronic
1062495180 9:136828172-136828194 GAGGGTTTGCTGCTGAAGGAAGG - Intronic
1062520690 9:136956642-136956664 CAGAGAAAGCTGCTGAAGGATGG + Intronic
1185962318 X:4558039-4558061 AATGGTTTTCTGGTGAAGGAGGG - Intergenic
1186549849 X:10492361-10492383 CAGGGTAGGCTGAGCAAGGAGGG - Intronic
1187680525 X:21762769-21762791 CAGCATCTGCTGGGGAAGGAGGG - Intergenic
1187724732 X:22190608-22190630 CAGGGTATGCTGGTGAAGGAAGG + Intronic
1188401996 X:29756839-29756861 GAGGTTATGCTGGTGTAGGGTGG + Intronic
1190340665 X:49292857-49292879 CAGGGGATGCTCGTGAATGGAGG + Intronic
1193188810 X:78545181-78545203 CAGTGCATGCTGGTGGGGGAAGG + Intergenic
1195047057 X:101063735-101063757 CAGGGTCTGGTGGTGGAGGGTGG - Intergenic
1195208978 X:102633115-102633137 CAGGGTATGAGGGTGTTGGAAGG + Intergenic
1196098062 X:111820841-111820863 AAGTGTATCCTGGTTAAGGATGG + Intronic
1196897414 X:120350949-120350971 CAGGCTATGCTAGTAATGGAAGG + Intergenic
1198129957 X:133683727-133683749 CAGCTTATGCTGCTGACGGATGG - Intronic
1198639722 X:138743370-138743392 CAGGGGTTGGTGGGGAAGGAGGG + Intronic
1199804268 X:151282296-151282318 CAGGGTGTGGTGATGAATGAGGG - Intergenic
1200053473 X:153446614-153446636 CAGTGGCTGCTGGGGAAGGAAGG + Intronic
1202170515 Y:22038852-22038874 AAGTGTATGCTTGTAAAGGAAGG + Intergenic
1202220849 Y:22547521-22547543 AAGTGTATGCTTGTAAAGGAAGG - Intergenic
1202322264 Y:23648142-23648164 AAGTGTATGCTTGTAAAGGAAGG + Intergenic
1202548506 Y:26021914-26021936 AAGTGTATGCTTGTAAAGGAAGG - Intergenic