ID: 1187730243

View in Genome Browser
Species Human (GRCh38)
Location X:22245395-22245417
Sequence TCCCCCTCAGTTTAGGTAAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187730237_1187730243 18 Left 1187730237 X:22245354-22245376 CCAGAAGCTGCCCGAGAACAAGT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1187730243 X:22245395-22245417 TCCCCCTCAGTTTAGGTAAATGG 0: 1
1: 0
2: 0
3: 9
4: 92
1187730241_1187730243 -5 Left 1187730241 X:22245377-22245399 CCAAATTGGTGCTCACAGTCCCC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1187730243 X:22245395-22245417 TCCCCCTCAGTTTAGGTAAATGG 0: 1
1: 0
2: 0
3: 9
4: 92
1187730240_1187730243 7 Left 1187730240 X:22245365-22245387 CCGAGAACAAGTCCAAATTGGTG 0: 1
1: 0
2: 1
3: 10
4: 133
Right 1187730243 X:22245395-22245417 TCCCCCTCAGTTTAGGTAAATGG 0: 1
1: 0
2: 0
3: 9
4: 92
1187730236_1187730243 26 Left 1187730236 X:22245346-22245368 CCTACAGACCAGAAGCTGCCCGA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1187730243 X:22245395-22245417 TCCCCCTCAGTTTAGGTAAATGG 0: 1
1: 0
2: 0
3: 9
4: 92
1187730239_1187730243 8 Left 1187730239 X:22245364-22245386 CCCGAGAACAAGTCCAAATTGGT 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1187730243 X:22245395-22245417 TCCCCCTCAGTTTAGGTAAATGG 0: 1
1: 0
2: 0
3: 9
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187730243 Original CRISPR TCCCCCTCAGTTTAGGTAAA TGG Exonic
900836459 1:5008543-5008565 TGCCTGTCAGTTTAGGTAGATGG + Intergenic
903906914 1:26694305-26694327 TCCCCCTCAGATTTTGTAAAGGG - Intergenic
909464759 1:75960865-75960887 TCCTCCTCAGCTTACGAAAATGG - Intergenic
911172799 1:94786710-94786732 TCCCACTAAGTTCAGGTAAAAGG + Intergenic
911689678 1:100818963-100818985 TCCCTCTAAGTTCAGGAAAAAGG - Intergenic
912931053 1:113962119-113962141 TTCCCCTCAGGTTAGGTTAATGG - Intronic
917254978 1:173104569-173104591 TCCCCCTAAGATCAGATAAAAGG - Intergenic
922434223 1:225587116-225587138 TCCCCCTAAGGTCAGGTAGAAGG + Intronic
923780388 1:237017255-237017277 TCCCCCTAAGATTAGGAAACAGG - Intergenic
1064269730 10:13853889-13853911 TCCCCATCACTTTAGATGAATGG - Intronic
1068891733 10:62155301-62155323 TCCCCCTAATTTTAGGAAGAGGG - Intergenic
1071323903 10:84492537-84492559 TTCCCCTTAGATTAGGAAAAAGG - Intronic
1074545199 10:114396820-114396842 TCTCCCTCTGTTTAGAGAAAAGG - Intronic
1074966675 10:118496860-118496882 TCTCCCTCAGCTCAGGTAACAGG + Intergenic
1075252186 10:120889633-120889655 TCCTCCCAAGTTTAGGTGAAGGG - Intronic
1075549220 10:123379720-123379742 TCCTCCACAGTTTAGGTACCCGG + Intergenic
1084496240 11:69505317-69505339 TCCTCCTCAGGTTATGTAAGAGG - Intergenic
1084711048 11:70843945-70843967 TCCTCCTCAGTTTGGGGACACGG + Intronic
1092710693 12:11334318-11334340 TCCCCGTAAGTTTATGTGAATGG + Intergenic
1096567556 12:52493900-52493922 CTCCCTTCATTTTAGGTAAACGG - Intergenic
1098299210 12:69036981-69037003 GCCCCTGCAGTTTAGTTAAAGGG - Intergenic
1100577165 12:95903456-95903478 TCCCCCTAAGATTAGGAACAAGG - Intronic
1101374626 12:104160789-104160811 TCCCCCTAAGATTAGTTATAAGG - Intergenic
1106204628 13:27580286-27580308 TCCCCCTCATTTTATGAATAAGG - Intronic
1107261028 13:38491378-38491400 TCCCCCTAATATTAGGAAAAAGG - Intergenic
1113834365 13:113319120-113319142 TCACCCTCACTTTAGGAAGAGGG + Intronic
1114384012 14:22237713-22237735 TCCCTCCCAATTTAGGTATACGG + Intergenic
1118067652 14:62209381-62209403 TCATCCTCAGTTTATTTAAACGG - Intergenic
1124508900 15:30305680-30305702 TCCCCCTAAGTTCAGGGACAAGG - Intergenic
1124734658 15:32232982-32233004 TCCCCCTAAGTTCAGGGACAAGG + Intergenic
1126382247 15:48061098-48061120 TCCACCTCATTTTTGGTATACGG + Intergenic
1128878410 15:71221160-71221182 TCCCCCTCAGTTTCTGGAAATGG + Intronic
1134833847 16:17345337-17345359 TCCTCCTCTGTTTAGGTAGCTGG - Intronic
1140213271 16:72987451-72987473 GCCACCTCAGTTTAGGTAGAGGG + Intronic
1149243976 17:54683547-54683569 TCCGCCTCACTTTAGGTGGAAGG + Intergenic
1149807355 17:59631300-59631322 TCCCACTCAGTATACGTAACAGG - Intronic
1152074018 17:78147689-78147711 TCCCCCTCTATTTTGCTAAAGGG + Intronic
1156369243 18:36457953-36457975 TACCCCTCAGTATAGGTCAGAGG - Intronic
1159755611 18:72360290-72360312 TCTCCCTCAGTTTATTTAATGGG + Intergenic
1163602778 19:18258795-18258817 TCCCCCTCAGTTTATCAACAGGG - Intronic
1166769134 19:45270221-45270243 TCACCCTCAGTTTACATACAAGG + Intronic
927346433 2:22048746-22048768 TCCCCATCAGTTTTGTCAAAAGG - Intergenic
927366562 2:22304246-22304268 TCCCCCTAAGATTAGGAACAAGG + Intergenic
927392296 2:22609182-22609204 TCCCTCTCCATTTAGGAAAATGG - Intergenic
927623435 2:24687193-24687215 TCACACTCAGTTCAGGTAAAAGG - Intronic
927813780 2:26196006-26196028 TCCCTCTCACTTTAGCTATAAGG + Intronic
931384267 2:61783236-61783258 TCCCCCTAAGATTAGGAACAAGG + Intergenic
940334780 2:152514446-152514468 TCCTCATTATTTTAGGTAAAAGG - Intronic
943571630 2:189581198-189581220 TACCCCGCAGTTCAGGGAAAGGG + Intronic
946162811 2:217846447-217846469 TTCCCCTAAATTTAGGAAAAGGG + Intronic
1171432891 20:25096107-25096129 TCCCCTTAATTTTGGGTAAAAGG + Intergenic
1172934195 20:38608014-38608036 TTCCTCTCAGTTGAGGAAAAAGG + Intronic
1174175210 20:48640286-48640308 TCCTCCTCTGTGTAGGGAAAGGG - Intronic
1178816071 21:35930721-35930743 ACCATCTCAGTTTAGATAAAAGG - Intronic
1178950559 21:36981830-36981852 TCCTTCTCAGTTTAGGGGAATGG + Intronic
1179914349 21:44466850-44466872 ACCCCCTGAGTTCAGGTACAGGG + Intergenic
1183689122 22:39378257-39378279 CACCCCTCAGTTCAGGTAAGTGG - Intronic
952306054 3:32147420-32147442 TTCCCCTCTTTTGAGGTAAAGGG + Intronic
952352781 3:32556654-32556676 TCCACCTCAGCTTAAGTAATCGG + Intronic
956400926 3:68878930-68878952 TCCCCCCCAGTTTTGGCAGATGG - Intronic
961587230 3:127941932-127941954 TCCCCCTAAGTTCATGAAAAAGG + Intronic
962979212 3:140472663-140472685 TCCCCCTCTGTTTAGGACACTGG - Intronic
963570310 3:146986463-146986485 TGCACCGCAGTTTAGGCAAAGGG - Intergenic
964454428 3:156846384-156846406 TCCCCCTAAGGTTGGGAAAATGG - Intronic
964541735 3:157787161-157787183 TCCCCCTTTGTTTAGGTGAGGGG - Intergenic
966781575 3:183588724-183588746 TCCCCTTCAGTTTTGTTCAAGGG - Intergenic
968163946 3:196449192-196449214 TCCCCCACAGATCAGCTAAAAGG + Intergenic
968595775 4:1482414-1482436 TCTCCCTAAGGTTAGGAAAAAGG - Intergenic
969142323 4:5089041-5089063 TCTCAATCAGTCTAGGTAAAAGG - Intronic
970181450 4:13400628-13400650 TCCACCTAAGATTAGGTACAAGG - Intronic
978833286 4:113115594-113115616 TTCAACTCAGTTTAGGTAAAAGG + Intronic
978883301 4:113734873-113734895 TACTCCTAAGTTTAGGAAAATGG + Intronic
987971563 5:24952816-24952838 TACCCCTCAGTTTGGCTAATGGG - Intergenic
991089773 5:62682927-62682949 TCTCCCTCAGTTTACGTAGGTGG + Intergenic
992276027 5:75119938-75119960 ACCCCATCATTTTAGCTAAAAGG + Intronic
995291676 5:110463621-110463643 TCCACCTGATTTTAGTTAAATGG + Intronic
997166572 5:131666369-131666391 TCCCCCTCTGTTTTAGTAATTGG - Intronic
1001564624 5:172691567-172691589 TCCCCATCAGTGTATGTAAGTGG - Intergenic
1012785622 6:103621886-103621908 TCTCCCTCAGGTCTGGTAAATGG + Intergenic
1014436052 6:121421748-121421770 TCTTCCTGATTTTAGGTAAAAGG - Intergenic
1015865801 6:137725212-137725234 ACCCCCTCATTTTAGGGATATGG - Intergenic
1023993966 7:45147261-45147283 TCCTCCTGAGTTTCGGGAAATGG + Intergenic
1024758418 7:52564232-52564254 TCCCTCCCAGTGTAGGTATACGG - Intergenic
1028528539 7:91812462-91812484 TCCCCCTCAGTCTAGGAAGAAGG + Intronic
1029777425 7:102692692-102692714 TACCCCTCAATTCAGTTAAATGG - Intergenic
1030967299 7:116008052-116008074 TTGCCCTCAGTTTAGATAAGTGG - Intronic
1032501650 7:132404299-132404321 TCCCCCATAGTCTAGGAAAAGGG - Intronic
1033633367 7:143183853-143183875 TCCACCTCAGTTTGAGGAAAAGG - Exonic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1036946861 8:13102275-13102297 TCCCACACAGTTTAGTCAAATGG - Intronic
1041972916 8:63763490-63763512 TCCCCATAAGATTAGGTACAAGG - Intergenic
1042743733 8:72080212-72080234 TCCCCCTAAGATTGGGAAAAAGG - Intronic
1045237098 8:100361967-100361989 TCCCCATCAGATTAGCTTAATGG + Intronic
1052644330 9:31213555-31213577 TCCCCCTAAGATCAGGAAAAAGG - Intergenic
1054991014 9:71327055-71327077 TCCTCCTCAGTTTCCGTAACTGG + Intronic
1060774240 9:126358860-126358882 TCCCCCTAAGATTTGGGAAAAGG - Intronic
1187730243 X:22245395-22245417 TCCCCCTCAGTTTAGGTAAATGG + Exonic
1188275688 X:28197841-28197863 TCCCCCTAAGATCAGGTACAAGG - Intergenic
1188992802 X:36844135-36844157 TCCTACTCAGTTCAGTTAAATGG + Intergenic
1194831017 X:98621894-98621916 ACCCCCTCAGTTTACATATAAGG - Intergenic
1198112276 X:133512510-133512532 TTCCCCTCAGCTGAGGTAACAGG - Intergenic
1201337178 Y:12893597-12893619 GCCCCCTCAGTTGAGGCAAAAGG - Intergenic