ID: 1187731867

View in Genome Browser
Species Human (GRCh38)
Location X:22263812-22263834
Sequence TGGCTACCAGAGCACTGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187731867_1187731874 26 Left 1187731867 X:22263812-22263834 CCACTACAGTGCTCTGGTAGCCA No data
Right 1187731874 X:22263861-22263883 TTTCTAAAAATACCAGGAATTGG No data
1187731867_1187731872 -2 Left 1187731867 X:22263812-22263834 CCACTACAGTGCTCTGGTAGCCA No data
Right 1187731872 X:22263833-22263855 CACAGGGGCAATGTCTTCACAGG No data
1187731867_1187731873 20 Left 1187731867 X:22263812-22263834 CCACTACAGTGCTCTGGTAGCCA No data
Right 1187731873 X:22263855-22263877 GCTGATTTTCTAAAAATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187731867 Original CRISPR TGGCTACCAGAGCACTGTAG TGG (reversed) Intergenic
No off target data available for this crispr