ID: 1187731872

View in Genome Browser
Species Human (GRCh38)
Location X:22263833-22263855
Sequence CACAGGGGCAATGTCTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187731867_1187731872 -2 Left 1187731867 X:22263812-22263834 CCACTACAGTGCTCTGGTAGCCA No data
Right 1187731872 X:22263833-22263855 CACAGGGGCAATGTCTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187731872 Original CRISPR CACAGGGGCAATGTCTTCAC AGG Intergenic
No off target data available for this crispr