ID: 1187731873

View in Genome Browser
Species Human (GRCh38)
Location X:22263855-22263877
Sequence GCTGATTTTCTAAAAATACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187731871_1187731873 0 Left 1187731871 X:22263832-22263854 CCACAGGGGCAATGTCTTCACAG No data
Right 1187731873 X:22263855-22263877 GCTGATTTTCTAAAAATACCAGG No data
1187731867_1187731873 20 Left 1187731867 X:22263812-22263834 CCACTACAGTGCTCTGGTAGCCA No data
Right 1187731873 X:22263855-22263877 GCTGATTTTCTAAAAATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187731873 Original CRISPR GCTGATTTTCTAAAAATACC AGG Intergenic
No off target data available for this crispr