ID: 1187731978

View in Genome Browser
Species Human (GRCh38)
Location X:22264627-22264649
Sequence ACCAGCAAGGACTTCGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187731978_1187731984 -9 Left 1187731978 X:22264627-22264649 CCAAGCCCGAAGTCCTTGCTGGT No data
Right 1187731984 X:22264641-22264663 CTTGCTGGTTCAAAGGCCCAGGG No data
1187731978_1187731990 19 Left 1187731978 X:22264627-22264649 CCAAGCCCGAAGTCCTTGCTGGT No data
Right 1187731990 X:22264669-22264691 CCAGAGGAATTGTTCTGTAAGGG No data
1187731978_1187731991 20 Left 1187731978 X:22264627-22264649 CCAAGCCCGAAGTCCTTGCTGGT No data
Right 1187731991 X:22264670-22264692 CAGAGGAATTGTTCTGTAAGGGG No data
1187731978_1187731992 26 Left 1187731978 X:22264627-22264649 CCAAGCCCGAAGTCCTTGCTGGT No data
Right 1187731992 X:22264676-22264698 AATTGTTCTGTAAGGGGAGCAGG No data
1187731978_1187731985 3 Left 1187731978 X:22264627-22264649 CCAAGCCCGAAGTCCTTGCTGGT No data
Right 1187731985 X:22264653-22264675 AAGGCCCAGGGAGAATCCAGAGG No data
1187731978_1187731983 -10 Left 1187731978 X:22264627-22264649 CCAAGCCCGAAGTCCTTGCTGGT No data
Right 1187731983 X:22264640-22264662 CCTTGCTGGTTCAAAGGCCCAGG No data
1187731978_1187731988 18 Left 1187731978 X:22264627-22264649 CCAAGCCCGAAGTCCTTGCTGGT No data
Right 1187731988 X:22264668-22264690 TCCAGAGGAATTGTTCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187731978 Original CRISPR ACCAGCAAGGACTTCGGGCT TGG (reversed) Intergenic
No off target data available for this crispr