ID: 1187731979

View in Genome Browser
Species Human (GRCh38)
Location X:22264632-22264654
Sequence TTTGAACCAGCAAGGACTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187731979_1187731990 14 Left 1187731979 X:22264632-22264654 CCCGAAGTCCTTGCTGGTTCAAA No data
Right 1187731990 X:22264669-22264691 CCAGAGGAATTGTTCTGTAAGGG No data
1187731979_1187731985 -2 Left 1187731979 X:22264632-22264654 CCCGAAGTCCTTGCTGGTTCAAA No data
Right 1187731985 X:22264653-22264675 AAGGCCCAGGGAGAATCCAGAGG No data
1187731979_1187731992 21 Left 1187731979 X:22264632-22264654 CCCGAAGTCCTTGCTGGTTCAAA No data
Right 1187731992 X:22264676-22264698 AATTGTTCTGTAAGGGGAGCAGG No data
1187731979_1187731993 26 Left 1187731979 X:22264632-22264654 CCCGAAGTCCTTGCTGGTTCAAA No data
Right 1187731993 X:22264681-22264703 TTCTGTAAGGGGAGCAGGCCTGG No data
1187731979_1187731988 13 Left 1187731979 X:22264632-22264654 CCCGAAGTCCTTGCTGGTTCAAA No data
Right 1187731988 X:22264668-22264690 TCCAGAGGAATTGTTCTGTAAGG No data
1187731979_1187731991 15 Left 1187731979 X:22264632-22264654 CCCGAAGTCCTTGCTGGTTCAAA No data
Right 1187731991 X:22264670-22264692 CAGAGGAATTGTTCTGTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187731979 Original CRISPR TTTGAACCAGCAAGGACTTC GGG (reversed) Intergenic
No off target data available for this crispr