ID: 1187731986

View in Genome Browser
Species Human (GRCh38)
Location X:22264657-22264679
Sequence AATTCCTCTGGATTCTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187731986_1187731994 7 Left 1187731986 X:22264657-22264679 CCCAGGGAGAATCCAGAGGAATT No data
Right 1187731994 X:22264687-22264709 AAGGGGAGCAGGCCTGGATGTGG No data
1187731986_1187731991 -10 Left 1187731986 X:22264657-22264679 CCCAGGGAGAATCCAGAGGAATT No data
Right 1187731991 X:22264670-22264692 CAGAGGAATTGTTCTGTAAGGGG No data
1187731986_1187731992 -4 Left 1187731986 X:22264657-22264679 CCCAGGGAGAATCCAGAGGAATT No data
Right 1187731992 X:22264676-22264698 AATTGTTCTGTAAGGGGAGCAGG No data
1187731986_1187731993 1 Left 1187731986 X:22264657-22264679 CCCAGGGAGAATCCAGAGGAATT No data
Right 1187731993 X:22264681-22264703 TTCTGTAAGGGGAGCAGGCCTGG No data
1187731986_1187731997 23 Left 1187731986 X:22264657-22264679 CCCAGGGAGAATCCAGAGGAATT No data
Right 1187731997 X:22264703-22264725 GATGTGGGCTGAGTAGTGAGTGG No data
1187731986_1187731995 8 Left 1187731986 X:22264657-22264679 CCCAGGGAGAATCCAGAGGAATT No data
Right 1187731995 X:22264688-22264710 AGGGGAGCAGGCCTGGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187731986 Original CRISPR AATTCCTCTGGATTCTCCCT GGG (reversed) Intergenic
No off target data available for this crispr