ID: 1187731988

View in Genome Browser
Species Human (GRCh38)
Location X:22264668-22264690
Sequence TCCAGAGGAATTGTTCTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187731979_1187731988 13 Left 1187731979 X:22264632-22264654 CCCGAAGTCCTTGCTGGTTCAAA No data
Right 1187731988 X:22264668-22264690 TCCAGAGGAATTGTTCTGTAAGG No data
1187731978_1187731988 18 Left 1187731978 X:22264627-22264649 CCAAGCCCGAAGTCCTTGCTGGT No data
Right 1187731988 X:22264668-22264690 TCCAGAGGAATTGTTCTGTAAGG No data
1187731982_1187731988 5 Left 1187731982 X:22264640-22264662 CCTTGCTGGTTCAAAGGCCCAGG No data
Right 1187731988 X:22264668-22264690 TCCAGAGGAATTGTTCTGTAAGG No data
1187731980_1187731988 12 Left 1187731980 X:22264633-22264655 CCGAAGTCCTTGCTGGTTCAAAG No data
Right 1187731988 X:22264668-22264690 TCCAGAGGAATTGTTCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187731988 Original CRISPR TCCAGAGGAATTGTTCTGTA AGG Intergenic
No off target data available for this crispr