ID: 1187731989

View in Genome Browser
Species Human (GRCh38)
Location X:22264669-22264691
Sequence CCCTTACAGAACAATTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187731989_1187731995 -4 Left 1187731989 X:22264669-22264691 CCAGAGGAATTGTTCTGTAAGGG No data
Right 1187731995 X:22264688-22264710 AGGGGAGCAGGCCTGGATGTGGG No data
1187731989_1187731994 -5 Left 1187731989 X:22264669-22264691 CCAGAGGAATTGTTCTGTAAGGG No data
Right 1187731994 X:22264687-22264709 AAGGGGAGCAGGCCTGGATGTGG No data
1187731989_1187731997 11 Left 1187731989 X:22264669-22264691 CCAGAGGAATTGTTCTGTAAGGG No data
Right 1187731997 X:22264703-22264725 GATGTGGGCTGAGTAGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187731989 Original CRISPR CCCTTACAGAACAATTCCTC TGG (reversed) Intergenic
No off target data available for this crispr