ID: 1187731990

View in Genome Browser
Species Human (GRCh38)
Location X:22264669-22264691
Sequence CCAGAGGAATTGTTCTGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187731978_1187731990 19 Left 1187731978 X:22264627-22264649 CCAAGCCCGAAGTCCTTGCTGGT No data
Right 1187731990 X:22264669-22264691 CCAGAGGAATTGTTCTGTAAGGG No data
1187731980_1187731990 13 Left 1187731980 X:22264633-22264655 CCGAAGTCCTTGCTGGTTCAAAG No data
Right 1187731990 X:22264669-22264691 CCAGAGGAATTGTTCTGTAAGGG No data
1187731982_1187731990 6 Left 1187731982 X:22264640-22264662 CCTTGCTGGTTCAAAGGCCCAGG No data
Right 1187731990 X:22264669-22264691 CCAGAGGAATTGTTCTGTAAGGG No data
1187731979_1187731990 14 Left 1187731979 X:22264632-22264654 CCCGAAGTCCTTGCTGGTTCAAA No data
Right 1187731990 X:22264669-22264691 CCAGAGGAATTGTTCTGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187731990 Original CRISPR CCAGAGGAATTGTTCTGTAA GGG Intergenic
No off target data available for this crispr