ID: 1187731993

View in Genome Browser
Species Human (GRCh38)
Location X:22264681-22264703
Sequence TTCTGTAAGGGGAGCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187731986_1187731993 1 Left 1187731986 X:22264657-22264679 CCCAGGGAGAATCCAGAGGAATT No data
Right 1187731993 X:22264681-22264703 TTCTGTAAGGGGAGCAGGCCTGG No data
1187731980_1187731993 25 Left 1187731980 X:22264633-22264655 CCGAAGTCCTTGCTGGTTCAAAG No data
Right 1187731993 X:22264681-22264703 TTCTGTAAGGGGAGCAGGCCTGG No data
1187731979_1187731993 26 Left 1187731979 X:22264632-22264654 CCCGAAGTCCTTGCTGGTTCAAA No data
Right 1187731993 X:22264681-22264703 TTCTGTAAGGGGAGCAGGCCTGG No data
1187731987_1187731993 0 Left 1187731987 X:22264658-22264680 CCAGGGAGAATCCAGAGGAATTG No data
Right 1187731993 X:22264681-22264703 TTCTGTAAGGGGAGCAGGCCTGG No data
1187731982_1187731993 18 Left 1187731982 X:22264640-22264662 CCTTGCTGGTTCAAAGGCCCAGG No data
Right 1187731993 X:22264681-22264703 TTCTGTAAGGGGAGCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187731993 Original CRISPR TTCTGTAAGGGGAGCAGGCC TGG Intergenic
No off target data available for this crispr