ID: 1187731997

View in Genome Browser
Species Human (GRCh38)
Location X:22264703-22264725
Sequence GATGTGGGCTGAGTAGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187731986_1187731997 23 Left 1187731986 X:22264657-22264679 CCCAGGGAGAATCCAGAGGAATT No data
Right 1187731997 X:22264703-22264725 GATGTGGGCTGAGTAGTGAGTGG No data
1187731989_1187731997 11 Left 1187731989 X:22264669-22264691 CCAGAGGAATTGTTCTGTAAGGG No data
Right 1187731997 X:22264703-22264725 GATGTGGGCTGAGTAGTGAGTGG No data
1187731987_1187731997 22 Left 1187731987 X:22264658-22264680 CCAGGGAGAATCCAGAGGAATTG No data
Right 1187731997 X:22264703-22264725 GATGTGGGCTGAGTAGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187731997 Original CRISPR GATGTGGGCTGAGTAGTGAG TGG Intergenic
No off target data available for this crispr