ID: 1187733184

View in Genome Browser
Species Human (GRCh38)
Location X:22277572-22277594
Sequence CTGTAAAACGTGAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187733184_1187733187 23 Left 1187733184 X:22277572-22277594 CCTTCCTGCCTCACGTTTTACAG No data
Right 1187733187 X:22277618-22277640 TTTTTTTTTTTCCCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187733184 Original CRISPR CTGTAAAACGTGAGGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr