ID: 1187733927

View in Genome Browser
Species Human (GRCh38)
Location X:22285007-22285029
Sequence TTCCATTTGGAGCCTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187733927_1187733933 19 Left 1187733927 X:22285007-22285029 CCCTCACCAGGCTCCAAATGGAA No data
Right 1187733933 X:22285049-22285071 GCTGTGAGAGATATTTATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187733927 Original CRISPR TTCCATTTGGAGCCTGGTGA GGG (reversed) Intergenic
No off target data available for this crispr