ID: 1187741080

View in Genome Browser
Species Human (GRCh38)
Location X:22355982-22356004
Sequence TTCCGAAGGGGTGTGGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187741073_1187741080 -6 Left 1187741073 X:22355965-22355987 CCTCTTAAGGTATGATGTTCCGA No data
Right 1187741080 X:22355982-22356004 TTCCGAAGGGGTGTGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187741080 Original CRISPR TTCCGAAGGGGTGTGGGGAG AGG Intergenic
No off target data available for this crispr