ID: 1187741372

View in Genome Browser
Species Human (GRCh38)
Location X:22359527-22359549
Sequence GTTTTAAAGGGACAATGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187741372_1187741380 5 Left 1187741372 X:22359527-22359549 CCCAATCATTGTCCCTTTAAAAC No data
Right 1187741380 X:22359555-22359577 ACAAAACTCTAGGGCAGCCAAGG No data
1187741372_1187741376 -5 Left 1187741372 X:22359527-22359549 CCCAATCATTGTCCCTTTAAAAC No data
Right 1187741376 X:22359545-22359567 AAAACCCAAAACAAAACTCTAGG No data
1187741372_1187741377 -4 Left 1187741372 X:22359527-22359549 CCCAATCATTGTCCCTTTAAAAC No data
Right 1187741377 X:22359546-22359568 AAACCCAAAACAAAACTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187741372 Original CRISPR GTTTTAAAGGGACAATGATT GGG (reversed) Intergenic
No off target data available for this crispr