ID: 1187741575

View in Genome Browser
Species Human (GRCh38)
Location X:22361833-22361855
Sequence CTAGCTCTGTATCTATTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187741573_1187741575 7 Left 1187741573 X:22361803-22361825 CCTTCATGGCTTTTAATTGTTTT No data
Right 1187741575 X:22361833-22361855 CTAGCTCTGTATCTATTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187741575 Original CRISPR CTAGCTCTGTATCTATTTAT GGG Intergenic
No off target data available for this crispr