ID: 1187742656

View in Genome Browser
Species Human (GRCh38)
Location X:22373189-22373211
Sequence GGCTGGATAGTTTTGGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187742647_1187742656 16 Left 1187742647 X:22373150-22373172 CCTTGCTGCACGGATGAAGTGTG No data
Right 1187742656 X:22373189-22373211 GGCTGGATAGTTTTGGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187742656 Original CRISPR GGCTGGATAGTTTTGGGAAC TGG Intergenic