ID: 1187743959

View in Genome Browser
Species Human (GRCh38)
Location X:22387942-22387964
Sequence GAGAACTATTGGCCTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187743959_1187743968 23 Left 1187743959 X:22387942-22387964 CCTGGAACAGGCCAATAGTTCTC No data
Right 1187743968 X:22387988-22388010 TTAAAATTCTCTAGGACCTTGGG No data
1187743959_1187743961 -3 Left 1187743959 X:22387942-22387964 CCTGGAACAGGCCAATAGTTCTC No data
Right 1187743961 X:22387962-22387984 CTCAAATCCTCTTCATGACTAGG No data
1187743959_1187743966 15 Left 1187743959 X:22387942-22387964 CCTGGAACAGGCCAATAGTTCTC No data
Right 1187743966 X:22387980-22388002 CTAGGGGGTTAAAATTCTCTAGG No data
1187743959_1187743962 -2 Left 1187743959 X:22387942-22387964 CCTGGAACAGGCCAATAGTTCTC No data
Right 1187743962 X:22387963-22387985 TCAAATCCTCTTCATGACTAGGG No data
1187743959_1187743969 27 Left 1187743959 X:22387942-22387964 CCTGGAACAGGCCAATAGTTCTC No data
Right 1187743969 X:22387992-22388014 AATTCTCTAGGACCTTGGGCAGG No data
1187743959_1187743963 -1 Left 1187743959 X:22387942-22387964 CCTGGAACAGGCCAATAGTTCTC No data
Right 1187743963 X:22387964-22387986 CAAATCCTCTTCATGACTAGGGG No data
1187743959_1187743967 22 Left 1187743959 X:22387942-22387964 CCTGGAACAGGCCAATAGTTCTC No data
Right 1187743967 X:22387987-22388009 GTTAAAATTCTCTAGGACCTTGG No data
1187743959_1187743964 0 Left 1187743959 X:22387942-22387964 CCTGGAACAGGCCAATAGTTCTC No data
Right 1187743964 X:22387965-22387987 AAATCCTCTTCATGACTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187743959 Original CRISPR GAGAACTATTGGCCTGTTCC AGG (reversed) Intergenic
No off target data available for this crispr