ID: 1187744244

View in Genome Browser
Species Human (GRCh38)
Location X:22390877-22390899
Sequence CTGTGAGGATTTAAAGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187744244_1187744250 25 Left 1187744244 X:22390877-22390899 CCTATTTCTTTAAATCCTCACAG No data
Right 1187744250 X:22390925-22390947 GACAATTGTCCATTGTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187744244 Original CRISPR CTGTGAGGATTTAAAGAAAT AGG (reversed) Intergenic
No off target data available for this crispr