ID: 1187745284

View in Genome Browser
Species Human (GRCh38)
Location X:22402799-22402821
Sequence GAACAATATAGGGACTGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187745284_1187745287 15 Left 1187745284 X:22402799-22402821 CCTTATCAGTCCCTATATTGTTC No data
Right 1187745287 X:22402837-22402859 ACTTTATCTGAGCATCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187745284 Original CRISPR GAACAATATAGGGACTGATA AGG (reversed) Intergenic