ID: 1187745287

View in Genome Browser
Species Human (GRCh38)
Location X:22402837-22402859
Sequence ACTTTATCTGAGCATCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187745284_1187745287 15 Left 1187745284 X:22402799-22402821 CCTTATCAGTCCCTATATTGTTC No data
Right 1187745287 X:22402837-22402859 ACTTTATCTGAGCATCTTAAAGG No data
1187745285_1187745287 5 Left 1187745285 X:22402809-22402831 CCCTATATTGTTCGAATCTTTCT No data
Right 1187745287 X:22402837-22402859 ACTTTATCTGAGCATCTTAAAGG No data
1187745283_1187745287 16 Left 1187745283 X:22402798-22402820 CCCTTATCAGTCCCTATATTGTT No data
Right 1187745287 X:22402837-22402859 ACTTTATCTGAGCATCTTAAAGG No data
1187745286_1187745287 4 Left 1187745286 X:22402810-22402832 CCTATATTGTTCGAATCTTTCTC No data
Right 1187745287 X:22402837-22402859 ACTTTATCTGAGCATCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187745287 Original CRISPR ACTTTATCTGAGCATCTTAA AGG Intergenic